ID: 937288846

View in Genome Browser
Species Human (GRCh38)
Location 2:120769844-120769866
Sequence GCTTTAAGTGTGTGGAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937288842_937288846 21 Left 937288842 2:120769800-120769822 CCTGTTTGGGAGTGTGTTGGGAA No data
Right 937288846 2:120769844-120769866 GCTTTAAGTGTGTGGAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937288846 Original CRISPR GCTTTAAGTGTGTGGAAGTT TGG Intronic
No off target data available for this crispr