ID: 937291090

View in Genome Browser
Species Human (GRCh38)
Location 2:120782514-120782536
Sequence AGCCTCTTGCTGCAAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937291090_937291096 27 Left 937291090 2:120782514-120782536 CCCACAGTTTGCAGCAAGAGGCT No data
Right 937291096 2:120782564-120782586 CACTGCCTCTTTACAGCTTAAGG No data
937291090_937291097 30 Left 937291090 2:120782514-120782536 CCCACAGTTTGCAGCAAGAGGCT No data
Right 937291097 2:120782567-120782589 TGCCTCTTTACAGCTTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937291090 Original CRISPR AGCCTCTTGCTGCAAACTGT GGG (reversed) Intronic