ID: 937291091

View in Genome Browser
Species Human (GRCh38)
Location 2:120782515-120782537
Sequence CAGCCTCTTGCTGCAAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937291091_937291096 26 Left 937291091 2:120782515-120782537 CCACAGTTTGCAGCAAGAGGCTG No data
Right 937291096 2:120782564-120782586 CACTGCCTCTTTACAGCTTAAGG No data
937291091_937291097 29 Left 937291091 2:120782515-120782537 CCACAGTTTGCAGCAAGAGGCTG No data
Right 937291097 2:120782567-120782589 TGCCTCTTTACAGCTTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937291091 Original CRISPR CAGCCTCTTGCTGCAAACTG TGG (reversed) Intronic