ID: 937291091 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:120782515-120782537 |
| Sequence | CAGCCTCTTGCTGCAAACTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937291091_937291097 | 29 | Left | 937291091 | 2:120782515-120782537 | CCACAGTTTGCAGCAAGAGGCTG | No data | ||
| Right | 937291097 | 2:120782567-120782589 | TGCCTCTTTACAGCTTAAGGTGG | No data | ||||
| 937291091_937291096 | 26 | Left | 937291091 | 2:120782515-120782537 | CCACAGTTTGCAGCAAGAGGCTG | No data | ||
| Right | 937291096 | 2:120782564-120782586 | CACTGCCTCTTTACAGCTTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937291091 | Original CRISPR | CAGCCTCTTGCTGCAAACTG TGG (reversed) | Intronic | ||