ID: 937291093

View in Genome Browser
Species Human (GRCh38)
Location 2:120782539-120782561
Sequence GCATACTGCATCTGAAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937291093_937291099 23 Left 937291093 2:120782539-120782561 CCCAGGCTTCAGATGCAGTATGC No data
Right 937291099 2:120782585-120782607 GGTGGTGAGACCTCCATCCCTGG No data
937291093_937291096 2 Left 937291093 2:120782539-120782561 CCCAGGCTTCAGATGCAGTATGC No data
Right 937291096 2:120782564-120782586 CACTGCCTCTTTACAGCTTAAGG No data
937291093_937291101 27 Left 937291093 2:120782539-120782561 CCCAGGCTTCAGATGCAGTATGC No data
Right 937291101 2:120782589-120782611 GTGAGACCTCCATCCCTGGGAGG No data
937291093_937291097 5 Left 937291093 2:120782539-120782561 CCCAGGCTTCAGATGCAGTATGC No data
Right 937291097 2:120782567-120782589 TGCCTCTTTACAGCTTAAGGTGG No data
937291093_937291100 24 Left 937291093 2:120782539-120782561 CCCAGGCTTCAGATGCAGTATGC No data
Right 937291100 2:120782586-120782608 GTGGTGAGACCTCCATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937291093 Original CRISPR GCATACTGCATCTGAAGCCT GGG (reversed) Intronic