ID: 937291094

View in Genome Browser
Species Human (GRCh38)
Location 2:120782540-120782562
Sequence TGCATACTGCATCTGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937291094_937291097 4 Left 937291094 2:120782540-120782562 CCAGGCTTCAGATGCAGTATGCA No data
Right 937291097 2:120782567-120782589 TGCCTCTTTACAGCTTAAGGTGG No data
937291094_937291101 26 Left 937291094 2:120782540-120782562 CCAGGCTTCAGATGCAGTATGCA No data
Right 937291101 2:120782589-120782611 GTGAGACCTCCATCCCTGGGAGG No data
937291094_937291099 22 Left 937291094 2:120782540-120782562 CCAGGCTTCAGATGCAGTATGCA No data
Right 937291099 2:120782585-120782607 GGTGGTGAGACCTCCATCCCTGG No data
937291094_937291096 1 Left 937291094 2:120782540-120782562 CCAGGCTTCAGATGCAGTATGCA No data
Right 937291096 2:120782564-120782586 CACTGCCTCTTTACAGCTTAAGG No data
937291094_937291100 23 Left 937291094 2:120782540-120782562 CCAGGCTTCAGATGCAGTATGCA No data
Right 937291100 2:120782586-120782608 GTGGTGAGACCTCCATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937291094 Original CRISPR TGCATACTGCATCTGAAGCC TGG (reversed) Intronic