ID: 937291096

View in Genome Browser
Species Human (GRCh38)
Location 2:120782564-120782586
Sequence CACTGCCTCTTTACAGCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937291091_937291096 26 Left 937291091 2:120782515-120782537 CCACAGTTTGCAGCAAGAGGCTG No data
Right 937291096 2:120782564-120782586 CACTGCCTCTTTACAGCTTAAGG No data
937291093_937291096 2 Left 937291093 2:120782539-120782561 CCCAGGCTTCAGATGCAGTATGC No data
Right 937291096 2:120782564-120782586 CACTGCCTCTTTACAGCTTAAGG No data
937291094_937291096 1 Left 937291094 2:120782540-120782562 CCAGGCTTCAGATGCAGTATGCA No data
Right 937291096 2:120782564-120782586 CACTGCCTCTTTACAGCTTAAGG No data
937291090_937291096 27 Left 937291090 2:120782514-120782536 CCCACAGTTTGCAGCAAGAGGCT No data
Right 937291096 2:120782564-120782586 CACTGCCTCTTTACAGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937291096 Original CRISPR CACTGCCTCTTTACAGCTTA AGG Intronic