ID: 937291097

View in Genome Browser
Species Human (GRCh38)
Location 2:120782567-120782589
Sequence TGCCTCTTTACAGCTTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937291091_937291097 29 Left 937291091 2:120782515-120782537 CCACAGTTTGCAGCAAGAGGCTG No data
Right 937291097 2:120782567-120782589 TGCCTCTTTACAGCTTAAGGTGG No data
937291093_937291097 5 Left 937291093 2:120782539-120782561 CCCAGGCTTCAGATGCAGTATGC No data
Right 937291097 2:120782567-120782589 TGCCTCTTTACAGCTTAAGGTGG No data
937291094_937291097 4 Left 937291094 2:120782540-120782562 CCAGGCTTCAGATGCAGTATGCA No data
Right 937291097 2:120782567-120782589 TGCCTCTTTACAGCTTAAGGTGG No data
937291090_937291097 30 Left 937291090 2:120782514-120782536 CCCACAGTTTGCAGCAAGAGGCT No data
Right 937291097 2:120782567-120782589 TGCCTCTTTACAGCTTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937291097 Original CRISPR TGCCTCTTTACAGCTTAAGG TGG Intronic