ID: 937292074

View in Genome Browser
Species Human (GRCh38)
Location 2:120787748-120787770
Sequence AGCACCGCTGACCCAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937292074_937292083 6 Left 937292074 2:120787748-120787770 CCCTCTGCTGGGTCAGCGGTGCT No data
Right 937292083 2:120787777-120787799 GTGGTGTCAGGGAGAGACCCTGG No data
937292074_937292081 -6 Left 937292074 2:120787748-120787770 CCCTCTGCTGGGTCAGCGGTGCT No data
Right 937292081 2:120787765-120787787 GGTGCTGGGGGAGTGGTGTCAGG No data
937292074_937292085 22 Left 937292074 2:120787748-120787770 CCCTCTGCTGGGTCAGCGGTGCT No data
Right 937292085 2:120787793-120787815 ACCCTGGACCTCTAGGCTTCAGG No data
937292074_937292082 -5 Left 937292074 2:120787748-120787770 CCCTCTGCTGGGTCAGCGGTGCT No data
Right 937292082 2:120787766-120787788 GTGCTGGGGGAGTGGTGTCAGGG No data
937292074_937292084 15 Left 937292074 2:120787748-120787770 CCCTCTGCTGGGTCAGCGGTGCT No data
Right 937292084 2:120787786-120787808 GGGAGAGACCCTGGACCTCTAGG No data
937292074_937292087 23 Left 937292074 2:120787748-120787770 CCCTCTGCTGGGTCAGCGGTGCT No data
Right 937292087 2:120787794-120787816 CCCTGGACCTCTAGGCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937292074 Original CRISPR AGCACCGCTGACCCAGCAGA GGG (reversed) Intronic
No off target data available for this crispr