ID: 937294174

View in Genome Browser
Species Human (GRCh38)
Location 2:120799784-120799806
Sequence TGGAGCCTTCTGGGGGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937294174_937294181 -5 Left 937294174 2:120799784-120799806 CCTGAGTCCCCCAGAAGGCTCCA No data
Right 937294181 2:120799802-120799824 CTCCAAAGAGCCATGGATGTGGG No data
937294174_937294184 10 Left 937294174 2:120799784-120799806 CCTGAGTCCCCCAGAAGGCTCCA No data
Right 937294184 2:120799817-120799839 GATGTGGGCCTCACTGCCTGCGG No data
937294174_937294180 -6 Left 937294174 2:120799784-120799806 CCTGAGTCCCCCAGAAGGCTCCA No data
Right 937294180 2:120799801-120799823 GCTCCAAAGAGCCATGGATGTGG No data
937294174_937294185 11 Left 937294174 2:120799784-120799806 CCTGAGTCCCCCAGAAGGCTCCA No data
Right 937294185 2:120799818-120799840 ATGTGGGCCTCACTGCCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937294174 Original CRISPR TGGAGCCTTCTGGGGGACTC AGG (reversed) Intronic
No off target data available for this crispr