ID: 937294207

View in Genome Browser
Species Human (GRCh38)
Location 2:120799915-120799937
Sequence GAGCATCCCCGCCCCTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937294207_937294217 27 Left 937294207 2:120799915-120799937 CCCCCTCAGGGGCGGGGATGCTC No data
Right 937294217 2:120799965-120799987 TGGTGCTGGGCCTGGCATGAGGG No data
937294207_937294212 7 Left 937294207 2:120799915-120799937 CCCCCTCAGGGGCGGGGATGCTC No data
Right 937294212 2:120799945-120799967 CATCTCTAGGTCTCAGCATCTGG No data
937294207_937294213 13 Left 937294207 2:120799915-120799937 CCCCCTCAGGGGCGGGGATGCTC No data
Right 937294213 2:120799951-120799973 TAGGTCTCAGCATCTGGTGCTGG No data
937294207_937294214 14 Left 937294207 2:120799915-120799937 CCCCCTCAGGGGCGGGGATGCTC No data
Right 937294214 2:120799952-120799974 AGGTCTCAGCATCTGGTGCTGGG No data
937294207_937294216 26 Left 937294207 2:120799915-120799937 CCCCCTCAGGGGCGGGGATGCTC No data
Right 937294216 2:120799964-120799986 CTGGTGCTGGGCCTGGCATGAGG No data
937294207_937294218 28 Left 937294207 2:120799915-120799937 CCCCCTCAGGGGCGGGGATGCTC No data
Right 937294218 2:120799966-120799988 GGTGCTGGGCCTGGCATGAGGGG No data
937294207_937294211 -6 Left 937294207 2:120799915-120799937 CCCCCTCAGGGGCGGGGATGCTC No data
Right 937294211 2:120799932-120799954 ATGCTCTTGTGTTCATCTCTAGG No data
937294207_937294215 19 Left 937294207 2:120799915-120799937 CCCCCTCAGGGGCGGGGATGCTC No data
Right 937294215 2:120799957-120799979 TCAGCATCTGGTGCTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937294207 Original CRISPR GAGCATCCCCGCCCCTGAGG GGG (reversed) Intronic