ID: 937294209

View in Genome Browser
Species Human (GRCh38)
Location 2:120799917-120799939
Sequence AAGAGCATCCCCGCCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937294209_937294216 24 Left 937294209 2:120799917-120799939 CCCTCAGGGGCGGGGATGCTCTT No data
Right 937294216 2:120799964-120799986 CTGGTGCTGGGCCTGGCATGAGG No data
937294209_937294215 17 Left 937294209 2:120799917-120799939 CCCTCAGGGGCGGGGATGCTCTT No data
Right 937294215 2:120799957-120799979 TCAGCATCTGGTGCTGGGCCTGG No data
937294209_937294218 26 Left 937294209 2:120799917-120799939 CCCTCAGGGGCGGGGATGCTCTT No data
Right 937294218 2:120799966-120799988 GGTGCTGGGCCTGGCATGAGGGG No data
937294209_937294217 25 Left 937294209 2:120799917-120799939 CCCTCAGGGGCGGGGATGCTCTT No data
Right 937294217 2:120799965-120799987 TGGTGCTGGGCCTGGCATGAGGG No data
937294209_937294212 5 Left 937294209 2:120799917-120799939 CCCTCAGGGGCGGGGATGCTCTT No data
Right 937294212 2:120799945-120799967 CATCTCTAGGTCTCAGCATCTGG No data
937294209_937294214 12 Left 937294209 2:120799917-120799939 CCCTCAGGGGCGGGGATGCTCTT No data
Right 937294214 2:120799952-120799974 AGGTCTCAGCATCTGGTGCTGGG No data
937294209_937294213 11 Left 937294209 2:120799917-120799939 CCCTCAGGGGCGGGGATGCTCTT No data
Right 937294213 2:120799951-120799973 TAGGTCTCAGCATCTGGTGCTGG No data
937294209_937294211 -8 Left 937294209 2:120799917-120799939 CCCTCAGGGGCGGGGATGCTCTT No data
Right 937294211 2:120799932-120799954 ATGCTCTTGTGTTCATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937294209 Original CRISPR AAGAGCATCCCCGCCCCTGA GGG (reversed) Intronic