ID: 937294210

View in Genome Browser
Species Human (GRCh38)
Location 2:120799918-120799940
Sequence CAAGAGCATCCCCGCCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937294210_937294211 -9 Left 937294210 2:120799918-120799940 CCTCAGGGGCGGGGATGCTCTTG No data
Right 937294211 2:120799932-120799954 ATGCTCTTGTGTTCATCTCTAGG No data
937294210_937294216 23 Left 937294210 2:120799918-120799940 CCTCAGGGGCGGGGATGCTCTTG No data
Right 937294216 2:120799964-120799986 CTGGTGCTGGGCCTGGCATGAGG No data
937294210_937294215 16 Left 937294210 2:120799918-120799940 CCTCAGGGGCGGGGATGCTCTTG No data
Right 937294215 2:120799957-120799979 TCAGCATCTGGTGCTGGGCCTGG No data
937294210_937294217 24 Left 937294210 2:120799918-120799940 CCTCAGGGGCGGGGATGCTCTTG No data
Right 937294217 2:120799965-120799987 TGGTGCTGGGCCTGGCATGAGGG No data
937294210_937294214 11 Left 937294210 2:120799918-120799940 CCTCAGGGGCGGGGATGCTCTTG No data
Right 937294214 2:120799952-120799974 AGGTCTCAGCATCTGGTGCTGGG No data
937294210_937294212 4 Left 937294210 2:120799918-120799940 CCTCAGGGGCGGGGATGCTCTTG No data
Right 937294212 2:120799945-120799967 CATCTCTAGGTCTCAGCATCTGG No data
937294210_937294218 25 Left 937294210 2:120799918-120799940 CCTCAGGGGCGGGGATGCTCTTG No data
Right 937294218 2:120799966-120799988 GGTGCTGGGCCTGGCATGAGGGG No data
937294210_937294213 10 Left 937294210 2:120799918-120799940 CCTCAGGGGCGGGGATGCTCTTG No data
Right 937294213 2:120799951-120799973 TAGGTCTCAGCATCTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937294210 Original CRISPR CAAGAGCATCCCCGCCCCTG AGG (reversed) Intronic