ID: 937294211

View in Genome Browser
Species Human (GRCh38)
Location 2:120799932-120799954
Sequence ATGCTCTTGTGTTCATCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937294207_937294211 -6 Left 937294207 2:120799915-120799937 CCCCCTCAGGGGCGGGGATGCTC No data
Right 937294211 2:120799932-120799954 ATGCTCTTGTGTTCATCTCTAGG No data
937294210_937294211 -9 Left 937294210 2:120799918-120799940 CCTCAGGGGCGGGGATGCTCTTG No data
Right 937294211 2:120799932-120799954 ATGCTCTTGTGTTCATCTCTAGG No data
937294209_937294211 -8 Left 937294209 2:120799917-120799939 CCCTCAGGGGCGGGGATGCTCTT No data
Right 937294211 2:120799932-120799954 ATGCTCTTGTGTTCATCTCTAGG No data
937294208_937294211 -7 Left 937294208 2:120799916-120799938 CCCCTCAGGGGCGGGGATGCTCT No data
Right 937294211 2:120799932-120799954 ATGCTCTTGTGTTCATCTCTAGG No data
937294198_937294211 23 Left 937294198 2:120799886-120799908 CCTGGAAGCTGCAGGTGGTTGGC No data
Right 937294211 2:120799932-120799954 ATGCTCTTGTGTTCATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937294211 Original CRISPR ATGCTCTTGTGTTCATCTCT AGG Intronic