ID: 937294216

View in Genome Browser
Species Human (GRCh38)
Location 2:120799964-120799986
Sequence CTGGTGCTGGGCCTGGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937294210_937294216 23 Left 937294210 2:120799918-120799940 CCTCAGGGGCGGGGATGCTCTTG No data
Right 937294216 2:120799964-120799986 CTGGTGCTGGGCCTGGCATGAGG No data
937294209_937294216 24 Left 937294209 2:120799917-120799939 CCCTCAGGGGCGGGGATGCTCTT No data
Right 937294216 2:120799964-120799986 CTGGTGCTGGGCCTGGCATGAGG No data
937294208_937294216 25 Left 937294208 2:120799916-120799938 CCCCTCAGGGGCGGGGATGCTCT No data
Right 937294216 2:120799964-120799986 CTGGTGCTGGGCCTGGCATGAGG No data
937294207_937294216 26 Left 937294207 2:120799915-120799937 CCCCCTCAGGGGCGGGGATGCTC No data
Right 937294216 2:120799964-120799986 CTGGTGCTGGGCCTGGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937294216 Original CRISPR CTGGTGCTGGGCCTGGCATG AGG Intronic
No off target data available for this crispr