ID: 937295153

View in Genome Browser
Species Human (GRCh38)
Location 2:120805682-120805704
Sequence GACACAGCTGTCCCTCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937295148_937295153 7 Left 937295148 2:120805652-120805674 CCAATTCCGCAGGAACATTCCAT No data
Right 937295153 2:120805682-120805704 GACACAGCTGTCCCTCAACCTGG No data
937295149_937295153 1 Left 937295149 2:120805658-120805680 CCGCAGGAACATTCCATCACATG No data
Right 937295153 2:120805682-120805704 GACACAGCTGTCCCTCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937295153 Original CRISPR GACACAGCTGTCCCTCAACC TGG Intronic
No off target data available for this crispr