ID: 937296565

View in Genome Browser
Species Human (GRCh38)
Location 2:120813032-120813054
Sequence ACCCTTTCACAGCCATCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937296565_937296568 8 Left 937296565 2:120813032-120813054 CCAGACGATGGCTGTGAAAGGGT No data
Right 937296568 2:120813063-120813085 ATTTTCAGCATGCCACACACAGG No data
937296565_937296570 22 Left 937296565 2:120813032-120813054 CCAGACGATGGCTGTGAAAGGGT No data
Right 937296570 2:120813077-120813099 ACACACAGGATGTAAAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937296565 Original CRISPR ACCCTTTCACAGCCATCGTC TGG (reversed) Intronic
No off target data available for this crispr