ID: 937302056

View in Genome Browser
Species Human (GRCh38)
Location 2:120848584-120848606
Sequence GACCCTGGGGAGGGAAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937302046_937302056 19 Left 937302046 2:120848542-120848564 CCTATTCTTGGCAACTTTTGCAG No data
Right 937302056 2:120848584-120848606 GACCCTGGGGAGGGAAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937302056 Original CRISPR GACCCTGGGGAGGGAAGAGT TGG Intronic
No off target data available for this crispr