ID: 937303112

View in Genome Browser
Species Human (GRCh38)
Location 2:120855419-120855441
Sequence GTCCATCAGCATGTGTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937303111_937303112 0 Left 937303111 2:120855396-120855418 CCAAACAGTCTGCACAGTGCATT No data
Right 937303112 2:120855419-120855441 GTCCATCAGCATGTGTACCCAGG No data
937303110_937303112 1 Left 937303110 2:120855395-120855417 CCCAAACAGTCTGCACAGTGCAT No data
Right 937303112 2:120855419-120855441 GTCCATCAGCATGTGTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937303112 Original CRISPR GTCCATCAGCATGTGTACCC AGG Intronic
No off target data available for this crispr