ID: 937305407

View in Genome Browser
Species Human (GRCh38)
Location 2:120867595-120867617
Sequence CTGGGTAAGTTGAAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937305400_937305407 -10 Left 937305400 2:120867582-120867604 CCCTCCCCGCACGCTGGGTAAGT No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305395_937305407 -3 Left 937305395 2:120867575-120867597 CCCTCCGCCCTCCCCGCACGCTG No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305393_937305407 14 Left 937305393 2:120867558-120867580 CCCTCTGGGTGCTGCGTCCCTCC No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305394_937305407 13 Left 937305394 2:120867559-120867581 CCTCTGGGTGCTGCGTCCCTCCG No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305392_937305407 15 Left 937305392 2:120867557-120867579 CCCCTCTGGGTGCTGCGTCCCTC No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305396_937305407 -4 Left 937305396 2:120867576-120867598 CCTCCGCCCTCCCCGCACGCTGG No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305390_937305407 21 Left 937305390 2:120867551-120867573 CCGCCGCCCCTCTGGGTGCTGCG No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305389_937305407 26 Left 937305389 2:120867546-120867568 CCGCACCGCCGCCCCTCTGGGTG No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305391_937305407 18 Left 937305391 2:120867554-120867576 CCGCCCCTCTGGGTGCTGCGTCC No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305386_937305407 28 Left 937305386 2:120867544-120867566 CCCCGCACCGCCGCCCCTCTGGG No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305399_937305407 -7 Left 937305399 2:120867579-120867601 CCGCCCTCCCCGCACGCTGGGTA No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data
937305388_937305407 27 Left 937305388 2:120867545-120867567 CCCGCACCGCCGCCCCTCTGGGT No data
Right 937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937305407 Original CRISPR CTGGGTAAGTTGAAGGAGGA CGG Intronic
No off target data available for this crispr