ID: 937307472

View in Genome Browser
Species Human (GRCh38)
Location 2:120881353-120881375
Sequence GGAGAAGGACAGTGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937307455_937307472 26 Left 937307455 2:120881304-120881326 CCCAGGGTCCTGCTTGAATGTCA No data
Right 937307472 2:120881353-120881375 GGAGAAGGACAGTGGCAGGGAGG No data
937307456_937307472 25 Left 937307456 2:120881305-120881327 CCAGGGTCCTGCTTGAATGTCAG No data
Right 937307472 2:120881353-120881375 GGAGAAGGACAGTGGCAGGGAGG No data
937307454_937307472 27 Left 937307454 2:120881303-120881325 CCCCAGGGTCCTGCTTGAATGTC No data
Right 937307472 2:120881353-120881375 GGAGAAGGACAGTGGCAGGGAGG No data
937307458_937307472 18 Left 937307458 2:120881312-120881334 CCTGCTTGAATGTCAGAGGACAG No data
Right 937307472 2:120881353-120881375 GGAGAAGGACAGTGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937307472 Original CRISPR GGAGAAGGACAGTGGCAGGG AGG Intronic
No off target data available for this crispr