ID: 937312425

View in Genome Browser
Species Human (GRCh38)
Location 2:120910330-120910352
Sequence TAATTTATGCAAATGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937312419_937312425 -3 Left 937312419 2:120910310-120910332 CCTAATCAAGGGATGCATTTTAA No data
Right 937312425 2:120910330-120910352 TAATTTATGCAAATGGGGGAGGG No data
937312416_937312425 25 Left 937312416 2:120910282-120910304 CCTTGGCACGGTCTGTCAGGGCT No data
Right 937312425 2:120910330-120910352 TAATTTATGCAAATGGGGGAGGG No data
937312415_937312425 26 Left 937312415 2:120910281-120910303 CCCTTGGCACGGTCTGTCAGGGC No data
Right 937312425 2:120910330-120910352 TAATTTATGCAAATGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937312425 Original CRISPR TAATTTATGCAAATGGGGGA GGG Intronic
No off target data available for this crispr