ID: 937313393

View in Genome Browser
Species Human (GRCh38)
Location 2:120915851-120915873
Sequence GCTTCTGAGCAGCAGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937313393_937313396 -3 Left 937313393 2:120915851-120915873 CCTTGCAGCTGCTGCTCAGAAGC No data
Right 937313396 2:120915871-120915893 AGCACTGGTAAATGGTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937313393 Original CRISPR GCTTCTGAGCAGCAGCTGCA AGG (reversed) Intronic
No off target data available for this crispr