ID: 937313999

View in Genome Browser
Species Human (GRCh38)
Location 2:120919645-120919667
Sequence TGGGATTCACACCTGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937313995_937313999 -9 Left 937313995 2:120919631-120919653 CCAGCACTGTCCCCTGGGATTCA No data
Right 937313999 2:120919645-120919667 TGGGATTCACACCTGCAGCATGG No data
937313990_937313999 17 Left 937313990 2:120919605-120919627 CCAAAGGAGTCTCTCTCCACGTG No data
Right 937313999 2:120919645-120919667 TGGGATTCACACCTGCAGCATGG No data
937313992_937313999 1 Left 937313992 2:120919621-120919643 CCACGTGGCTCCAGCACTGTCCC No data
Right 937313999 2:120919645-120919667 TGGGATTCACACCTGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937313999 Original CRISPR TGGGATTCACACCTGCAGCA TGG Intronic
No off target data available for this crispr