ID: 937314557

View in Genome Browser
Species Human (GRCh38)
Location 2:120922750-120922772
Sequence TGGAATCCCCAGGAGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937314557_937314564 -9 Left 937314557 2:120922750-120922772 CCAGGCTCCTCCTGGGGATTCCA No data
Right 937314564 2:120922764-120922786 GGGATTCCAGGGGGTGAGAGAGG No data
937314557_937314566 0 Left 937314557 2:120922750-120922772 CCAGGCTCCTCCTGGGGATTCCA No data
Right 937314566 2:120922773-120922795 GGGGGTGAGAGAGGAGTGCACGG No data
937314557_937314568 23 Left 937314557 2:120922750-120922772 CCAGGCTCCTCCTGGGGATTCCA No data
Right 937314568 2:120922796-120922818 GTGCAGCCTGCACATTCCACAGG No data
937314557_937314567 1 Left 937314557 2:120922750-120922772 CCAGGCTCCTCCTGGGGATTCCA No data
Right 937314567 2:120922774-120922796 GGGGTGAGAGAGGAGTGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937314557 Original CRISPR TGGAATCCCCAGGAGGAGCC TGG (reversed) Intronic
No off target data available for this crispr