ID: 937316827

View in Genome Browser
Species Human (GRCh38)
Location 2:120937035-120937057
Sequence CCTTGGAAGGAGGGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937316827_937316836 3 Left 937316827 2:120937035-120937057 CCCTCCATCCCCTCCTTCCAAGG No data
Right 937316836 2:120937061-120937083 GCACCTCTGAAATGTACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937316827 Original CRISPR CCTTGGAAGGAGGGGATGGA GGG (reversed) Intronic
No off target data available for this crispr