ID: 937316859

View in Genome Browser
Species Human (GRCh38)
Location 2:120937201-120937223
Sequence GGGCCCGTATCCCCAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937316859_937316864 27 Left 937316859 2:120937201-120937223 CCAGGCACTGGGGATACGGGCCC No data
Right 937316864 2:120937251-120937273 TTTTTATTTGTATAAATTTATGG No data
937316859_937316865 28 Left 937316859 2:120937201-120937223 CCAGGCACTGGGGATACGGGCCC No data
Right 937316865 2:120937252-120937274 TTTTATTTGTATAAATTTATGGG No data
937316859_937316866 29 Left 937316859 2:120937201-120937223 CCAGGCACTGGGGATACGGGCCC No data
Right 937316866 2:120937253-120937275 TTTATTTGTATAAATTTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937316859 Original CRISPR GGGCCCGTATCCCCAGTGCC TGG (reversed) Intronic