ID: 937325724

View in Genome Browser
Species Human (GRCh38)
Location 2:120988748-120988770
Sequence CCCCGCGTGGCCGTGGCCAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937325724_937325742 26 Left 937325724 2:120988748-120988770 CCTATGGCCACGGCCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 937325742 2:120988797-120988819 TCCAGGCGGCGGAGCCAGGCGGG 0: 1
1: 0
2: 0
3: 26
4: 285
937325724_937325740 22 Left 937325724 2:120988748-120988770 CCTATGGCCACGGCCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 937325740 2:120988793-120988815 AGGCTCCAGGCGGCGGAGCCAGG 0: 1
1: 0
2: 4
3: 35
4: 269
937325724_937325729 2 Left 937325724 2:120988748-120988770 CCTATGGCCACGGCCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 937325729 2:120988773-120988795 TGCGCCCGCCTTCCCCCACGAGG 0: 1
1: 0
2: 0
3: 6
4: 121
937325724_937325737 15 Left 937325724 2:120988748-120988770 CCTATGGCCACGGCCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 937325737 2:120988786-120988808 CCCCACGAGGCTCCAGGCGGCGG 0: 1
1: 0
2: 2
3: 15
4: 180
937325724_937325741 25 Left 937325724 2:120988748-120988770 CCTATGGCCACGGCCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 937325741 2:120988796-120988818 CTCCAGGCGGCGGAGCCAGGCGG 0: 1
1: 0
2: 2
3: 41
4: 942
937325724_937325732 9 Left 937325724 2:120988748-120988770 CCTATGGCCACGGCCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 937325732 2:120988780-120988802 GCCTTCCCCCACGAGGCTCCAGG 0: 1
1: 0
2: 0
3: 17
4: 208
937325724_937325734 12 Left 937325724 2:120988748-120988770 CCTATGGCCACGGCCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 937325734 2:120988783-120988805 TTCCCCCACGAGGCTCCAGGCGG 0: 1
1: 0
2: 1
3: 14
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937325724 Original CRISPR CCCCGCGTGGCCGTGGCCAT AGG (reversed) Exonic
900457798 1:2785882-2785904 CCCCGCCTGGCCGTGCCCGCAGG + Exonic
903986731 1:27234431-27234453 CCCCGCACCGCCGTGGCCAATGG - Intergenic
905179131 1:36155965-36155987 GCCCGCTCGGCCGTGGCCGTGGG + Intronic
905202076 1:36322314-36322336 CCCAGGGTGCCCGTGGCCGTGGG + Exonic
906208179 1:43997943-43997965 CCAGGCTGGGCCGTGGCCATTGG - Exonic
906627136 1:47334246-47334268 GCCCGCGTGGCAGTGGCCGAGGG + Intronic
909548043 1:76868691-76868713 CCCCGCGGGACCGCGGCCACTGG + Exonic
914428616 1:147600240-147600262 CCCCGCGGGGCCGGGGCCAGCGG - Intronic
917345068 1:174021751-174021773 CCCCGCCTGGCCCAGGCCCTGGG + Intronic
920401567 1:205679845-205679867 CCCCGCGGCGCCGCGGCCGTCGG + Intronic
923043572 1:230337456-230337478 CACCCCGTGGCCTTGGCGATTGG + Intronic
923308388 1:232709658-232709680 CCCAGGGCGGCCGTCGCCATGGG - Intergenic
1062941273 10:1423125-1423147 CCACAGGTGGCCATGGCCATTGG + Intronic
1065579143 10:27154257-27154279 CCCCGCCGGGCCGTGGACAGAGG - Exonic
1070301954 10:75210461-75210483 CGGCGCGTGGCCGGGGCGATAGG - Intronic
1070749456 10:78955355-78955377 CACCGGGTGGCATTGGCCATAGG - Intergenic
1072059760 10:91798521-91798543 GCGCGCGTGGGCGCGGCCATGGG + Exonic
1073208572 10:101781232-101781254 CCCAGCGTGGCCCTGGGCCTGGG - Intergenic
1075326768 10:121539045-121539067 GCTCGCCTGCCCGTGGCCATTGG - Intronic
1076761229 10:132606747-132606769 GCCTCCGTGGCCGTGGGCATGGG - Intronic
1084700806 11:70785165-70785187 CCCCTCCTGGCCATGCCCATTGG - Intronic
1084966588 11:72747762-72747784 GCCCCCGTGGCCCTGGCCCTGGG - Intronic
1096530752 12:52241409-52241431 CCCAGGGTGGGCGTGGGCATAGG + Intronic
1097032716 12:56101222-56101244 CTCCGCGTGGCCGTGGGCTCCGG - Exonic
1106024758 13:25946254-25946276 CCCCGTGGGGACATGGCCATTGG - Intronic
1107412700 13:40172473-40172495 GCCCCCGTGGCAGTGGCCCTCGG - Intergenic
1113217670 13:108061210-108061232 CCTGGGGTGGCAGTGGCCATGGG + Intergenic
1116057921 14:39886260-39886282 CCCATGGTGGCAGTGGCCATAGG + Intergenic
1116872765 14:50083861-50083883 CCCTTGGTGGCCGTGGCCAGTGG - Exonic
1122016488 14:98801135-98801157 CCCAGAATGGCCCTGGCCATTGG - Intergenic
1122341122 14:101029164-101029186 CCCTGTGTGGCACTGGCCATGGG - Intergenic
1123110749 14:105865918-105865940 GCCCGGGTGGCGGTGGCCAGGGG + Intergenic
1132478135 16:152790-152812 CCCAGCCAGGCTGTGGCCATTGG - Exonic
1132480083 16:163002-163024 CCCAGCCAGGCTGTGGCCATTGG - Intronic
1132601279 16:774315-774337 CCCCGCCAGGCCGTGGGCCTGGG - Exonic
1132641950 16:982038-982060 CCCCGCGCGGCCCAGGCCCTCGG - Exonic
1132679201 16:1132842-1132864 CCTCGTGTGGCCGTGCACATGGG - Intergenic
1133224843 16:4336094-4336116 CCCAGCGTGGGCCTGGCCACAGG - Intronic
1133295285 16:4748933-4748955 CCCTGCTTGGCCGTGGTCACTGG + Exonic
1135976221 16:27110318-27110340 CCAGGCGTGGCCCTGGCCCTTGG + Intergenic
1136365192 16:29806438-29806460 CCCCGCGGGGCCGGGGCCGGGGG - Intronic
1136778918 16:32885385-32885407 GCCCGCGGGGCCGTCGCCCTTGG + Intergenic
1136891700 16:33976133-33976155 GCCCGCGGGGCCGTCGCCCTTGG - Intergenic
1141608828 16:85170124-85170146 CCCCGCGAGGCCCTGGCCCTGGG - Intergenic
1142145116 16:88489652-88489674 CCCCGCGGGGCCTGGGCCACAGG + Intronic
1142231707 16:88903145-88903167 GTCCGCGTGGCCGTGGCCCTGGG - Intronic
1203081330 16_KI270728v1_random:1147474-1147496 GCCCGCGGGGCCGTCGCCCTTGG + Intergenic
1143434566 17:6914164-6914186 CCACGCCTGGCCCTGGCCAAGGG - Intronic
1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG + Intergenic
1144628615 17:16858210-16858232 CCCCCCCTGGGTGTGGCCATCGG - Intergenic
1144777493 17:17792059-17792081 CCTTCCGTGGCCGTGGCCCTGGG + Intronic
1145128096 17:20318284-20318306 CCCCGCAGGGCGGGGGCCATGGG - Intronic
1147793756 17:43028535-43028557 CCTCCCTTGGCCGTGGCCATAGG + Exonic
1147898890 17:43770674-43770696 GCCCGCGTGGCAGAGGCCCTGGG + Intronic
1148321676 17:46759650-46759672 CCCCTGGTGGCCCTGGGCATAGG - Intergenic
1151360465 17:73585571-73585593 CCCCGCCTGGCCATGGAGATGGG - Intronic
1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG + Intronic
1154230452 18:12551927-12551949 CACCTCCTGGCAGTGGCCATGGG + Intronic
1154306167 18:13232464-13232486 CCCCGCGTGGCCTTGTCCGGGGG + Intronic
1154400798 18:14034848-14034870 CCCAGCCTGGCCATGGCCATTGG + Intergenic
1154500906 18:14997536-14997558 CTTAGCGTGGCCGTGGCCGTGGG - Intergenic
1160235119 18:77079335-77079357 CCCACAGTGGCCGTGGCCATGGG - Intronic
1160729258 19:633350-633372 CCCCGCGCGGCCGGGGCCTTTGG - Intronic
1162374415 19:10296331-10296353 CCCCGCAGGTCCGTGGCTATGGG + Exonic
1163443487 19:17333574-17333596 CCCCTCGTGGCAGGAGCCATCGG - Intronic
1163633762 19:18429321-18429343 GCCCGCGTTGCCATGGCGATGGG - Intronic
1164146997 19:22518308-22518330 CTGGGCGTGGCCGTGGCCGTGGG + Intronic
1166339662 19:42129899-42129921 CCTTGCCTGGCTGTGGCCATGGG - Intronic
1168574678 19:57500078-57500100 CTCAGCGTGGCCGCCGCCATCGG - Exonic
925179427 2:1807344-1807366 ACCCCCGTGGCTGTGGCCAGGGG + Intronic
937120470 2:119437111-119437133 CCCGGGCTGGCCGTGGGCATGGG + Exonic
937325724 2:120988748-120988770 CCCCGCGTGGCCGTGGCCATAGG - Exonic
938500078 2:131827725-131827747 CTCAGCGTGTCCGTGGCCGTGGG - Intergenic
941856367 2:170235149-170235171 TCCCACCTGGCCATGGCCATGGG + Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
947474473 2:230430704-230430726 CCCTGCCTGGGCATGGCCATAGG + Intronic
948667717 2:239546655-239546677 CCCCTCATGGCCGTGGCCAAGGG - Intergenic
1171986033 20:31661852-31661874 TCCCGCGTGGCCGCGTCCAGCGG - Intergenic
1174081005 20:47970733-47970755 CCCCGTGTGGCTGGGGCCAAGGG - Intergenic
1174135494 20:48376123-48376145 CCCCGTGTGGCTGGGGCCAGGGG + Intergenic
1175111092 20:56648456-56648478 CCCCGCGTCACAGTGGCCACAGG - Intergenic
1175267896 20:57713625-57713647 CTCAGCCTGGCTGTGGCCATGGG + Intergenic
1175684925 20:61021904-61021926 TGCCGCTTGGCAGTGGCCATCGG - Intergenic
1176311775 21:5154459-5154481 CCCCGCGTCCCCGAGGCCATGGG + Intronic
1179845275 21:44107576-44107598 CCCCGCGTCCCCGAGGCCACGGG - Intronic
1180194394 21:46184214-46184236 GCCCGAGGGGCCGTGGCCATGGG - Intronic
1183442290 22:37830080-37830102 CCCCCCATGGCCATGGCCCTGGG - Intergenic
1184741077 22:46429418-46429440 CCCGGCGTGGCTGTGGGCGTGGG + Intronic
1185116584 22:48941507-48941529 CCCCGCGAGGCCGTTGCCTGTGG - Intergenic
950421248 3:12901094-12901116 CGGCGGGTGGCCGTGGGCATGGG + Intronic
968199384 3:196739746-196739768 CCCCGCGCGGGCCTGCCCATGGG + Intergenic
968457235 4:705984-706006 CCCCGCCTGGCCTGGGCCCTCGG + Intronic
968766003 4:2469488-2469510 CCCTGGGGGGCCGCGGCCATGGG + Intronic
968983720 4:3864505-3864527 CCCCGGGAGGCCAAGGCCATGGG + Intergenic
969588898 4:8110091-8110113 CCACGCATGGCCCAGGCCATGGG + Intronic
970131462 4:12876170-12876192 CCCTGCCTGGACGTTGCCATGGG - Intergenic
973246565 4:48016686-48016708 CCCCGCCTGGCCATGCCCATTGG + Intronic
985781799 5:1875570-1875592 CTCCCCGTGGCCCTGGCCATAGG - Intergenic
988816406 5:34839097-34839119 CCCCGCGTCGCCATGGCTACAGG + Intronic
1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG + Exonic
1019626476 7:2018499-2018521 CCAGGCGTGGCCATGGCCAGAGG - Intronic
1024359695 7:48455174-48455196 CTCTTCGTGGCCTTGGCCATGGG + Exonic
1026883319 7:73921016-73921038 CCCCGCCTGGGCGTGCCCCTCGG - Intergenic
1027213031 7:76165698-76165720 CCCCCCGTGGCCATGGCCCCAGG + Intergenic
1035238280 7:157514376-157514398 CCCCGCCTGGCCGAGCCCACTGG - Intergenic
1035375151 7:158402745-158402767 CCCTGCCTGGCCATGGCCCTTGG - Intronic
1037595429 8:20350455-20350477 TCCCTCGTAGCTGTGGCCATGGG - Intergenic
1045252957 8:100496566-100496588 CCCACCGTGGCCATGGCCTTGGG + Intergenic
1049311244 8:141935011-141935033 CCTGGCATGGCCGTGCCCATTGG - Intergenic
1049427026 8:142542279-142542301 CGCAGCGTGGCCGTGGCCGTGGG - Exonic
1050602515 9:7267105-7267127 CCTGGCCTGGCCGTGGCCTTTGG + Intergenic
1056806462 9:89732764-89732786 CCCCGCGTGTCCATGACCTTGGG - Intergenic
1057881584 9:98796487-98796509 CCGCGCGTGGCGGCGGCGATGGG - Exonic
1062234055 9:135499787-135499809 TCCGGCGGGGCCGTGGCCTTGGG + Exonic
1062382625 9:136294766-136294788 CCTGGAGAGGCCGTGGCCATGGG - Intronic
1062499637 9:136846854-136846876 CTCAGCGTGTCCGTGGCCGTGGG + Exonic
1062554451 9:137107680-137107702 CCCCGCGTGGTCACGGCCACCGG + Intronic
1062568553 9:137173995-137174017 CCCCGCGAGGACGGCGCCATCGG + Intergenic
1185449723 X:275783-275805 CCCCGCGTGGCCCGGACCCTGGG - Intergenic
1190900851 X:54671946-54671968 CCTGGAGTGGCCGTGGCCGTGGG - Intergenic
1192234326 X:69286168-69286190 CCCCTTGTGGCCATGGCCCTTGG + Intergenic
1193664634 X:84300458-84300480 CCTGAGGTGGCCGTGGCCATGGG + Intergenic
1195136258 X:101909649-101909671 CCAGGGGTGGCCGTGGCTATGGG + Intronic