ID: 937326108

View in Genome Browser
Species Human (GRCh38)
Location 2:120990238-120990260
Sequence CACAGCATGCTCTACTACTA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937326094_937326108 15 Left 937326094 2:120990200-120990222 CCCAGCCGCCTCCGCAGGACGCA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 937326108 2:120990238-120990260 CACAGCATGCTCTACTACTACGG 0: 1
1: 0
2: 0
3: 4
4: 85
937326095_937326108 14 Left 937326095 2:120990201-120990223 CCAGCCGCCTCCGCAGGACGCAG 0: 1
1: 0
2: 1
3: 19
4: 191
Right 937326108 2:120990238-120990260 CACAGCATGCTCTACTACTACGG 0: 1
1: 0
2: 0
3: 4
4: 85
937326093_937326108 16 Left 937326093 2:120990199-120990221 CCCCAGCCGCCTCCGCAGGACGC 0: 1
1: 0
2: 0
3: 29
4: 285
Right 937326108 2:120990238-120990260 CACAGCATGCTCTACTACTACGG 0: 1
1: 0
2: 0
3: 4
4: 85
937326101_937326108 7 Left 937326101 2:120990208-120990230 CCTCCGCAGGACGCAGGTGGGGC 0: 1
1: 0
2: 0
3: 21
4: 169
Right 937326108 2:120990238-120990260 CACAGCATGCTCTACTACTACGG 0: 1
1: 0
2: 0
3: 4
4: 85
937326102_937326108 4 Left 937326102 2:120990211-120990233 CCGCAGGACGCAGGTGGGGCCCC 0: 1
1: 0
2: 0
3: 23
4: 236
Right 937326108 2:120990238-120990260 CACAGCATGCTCTACTACTACGG 0: 1
1: 0
2: 0
3: 4
4: 85
937326092_937326108 19 Left 937326092 2:120990196-120990218 CCTCCCCAGCCGCCTCCGCAGGA 0: 1
1: 0
2: 2
3: 54
4: 472
Right 937326108 2:120990238-120990260 CACAGCATGCTCTACTACTACGG 0: 1
1: 0
2: 0
3: 4
4: 85
937326097_937326108 10 Left 937326097 2:120990205-120990227 CCGCCTCCGCAGGACGCAGGTGG 0: 1
1: 0
2: 2
3: 8
4: 138
Right 937326108 2:120990238-120990260 CACAGCATGCTCTACTACTACGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937326108 Original CRISPR CACAGCATGCTCTACTACTA CGG Exonic