ID: 937326330

View in Genome Browser
Species Human (GRCh38)
Location 2:120991579-120991601
Sequence TCCCTAGGGCAGCCTGAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 381}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937326330_937326335 -5 Left 937326330 2:120991579-120991601 CCAGCCTCAGGCTGCCCTAGGGA 0: 1
1: 0
2: 1
3: 35
4: 381
Right 937326335 2:120991597-120991619 AGGGATCTCTCAGTAGGAAGAGG 0: 1
1: 0
2: 3
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937326330 Original CRISPR TCCCTAGGGCAGCCTGAGGC TGG (reversed) Exonic
900331204 1:2135509-2135531 TGACTAGGGCTGTCTGAGGCGGG + Intronic
900461780 1:2805241-2805263 TCCCTAGTGGAGCCTGGGGTCGG + Intergenic
901052249 1:6431054-6431076 GCCCTGGGGCAGCCAGAAGCAGG - Intronic
901056351 1:6450273-6450295 GCCCCAGAGCAGCCTGAGCCAGG + Intronic
901067299 1:6500398-6500420 TCCCAAGGGAAGCCCGGGGCAGG - Intronic
901215950 1:7555519-7555541 TCCCCAGGGCAGACAGAGCCAGG + Intronic
901772136 1:11535837-11535859 TCACTTGGGAAGACTGAGGCTGG - Intronic
902477995 1:16698212-16698234 GCCCCAGAGCAGCCTGAGCCAGG - Intergenic
902811146 1:18888776-18888798 TTCCCAGGACAGCCTGGGGCAGG - Intronic
902925422 1:19692830-19692852 TCCCTAGGATAGCATGTGGCAGG + Intronic
903258657 1:22119364-22119386 TCCCAGGGGCAGGCTGGGGCAGG + Exonic
903454416 1:23477263-23477285 TGCCTTGGGGAGGCTGAGGCAGG + Intronic
903825914 1:26145741-26145763 TTCCTAGGGCAGCCTGTATCTGG - Intergenic
903884210 1:26531529-26531551 TCTTTAGGGAATCCTGAGGCAGG + Intronic
904250807 1:29222851-29222873 TCCCTGGGGCAGGCCAAGGCTGG - Intronic
904939994 1:34158997-34159019 TCCCAAGGGCAGCTGGGGGCTGG - Intronic
905546020 1:38801281-38801303 TCCTGAGGGCAGCTTGATGCTGG + Intergenic
905633887 1:39536069-39536091 TAGCTAGGGGAGGCTGAGGCAGG + Intergenic
906368188 1:45228810-45228832 TCCCTAGAGCAGACTGAGATTGG + Intronic
906951193 1:50335599-50335621 TCCTTAGAGGAGCCTGATGCAGG + Intergenic
907035584 1:51213234-51213256 TCCCCTTGGGAGCCTGAGGCAGG + Intergenic
907134958 1:52131792-52131814 GCACTATGGCAGGCTGAGGCAGG - Intergenic
907402262 1:54232481-54232503 TCCCTTTGGGAGGCTGAGGCAGG + Intronic
907655990 1:56342385-56342407 AGCCTAGGGCAGCCTCAGCCAGG + Intergenic
907914431 1:58855606-58855628 TCCTAACGGCAGTCTGAGGCTGG - Intergenic
910205878 1:84748245-84748267 TCCCTAGGGCAGGCTGCAGGGGG - Intergenic
910899548 1:92105176-92105198 TCACTCTGGCAGGCTGAGGCGGG - Intronic
911193294 1:94969198-94969220 TACACAGGGCAGGCTGAGGCAGG - Intergenic
911584939 1:99679805-99679827 TCTCACAGGCAGCCTGAGGCAGG - Intronic
914711320 1:150216233-150216255 GCCCTTTGGGAGCCTGAGGCGGG - Intergenic
915591735 1:156874772-156874794 TCCCCAGGGGAGGATGAGGCAGG + Intronic
915677191 1:157542792-157542814 TCCGAAGGGCAGGGTGAGGCAGG + Intronic
919767613 1:201137258-201137280 AGCCTAGGGGAGGCTGAGGCTGG - Intronic
919795379 1:201318563-201318585 TCCCTAGGGCATCCTGAGCCTGG + Intronic
920843626 1:209575645-209575667 TCCCTAGGGCCAGCTGGGGCTGG + Intergenic
922063510 1:222114075-222114097 TCCCTTTGGGAGGCTGAGGCGGG - Intergenic
922774901 1:228210201-228210223 CCCCTTGGGCAGTCTGAGGCTGG - Intronic
922779267 1:228238428-228238450 TCCCTAGTGCAGCTGCAGGCAGG + Intronic
924520666 1:244803311-244803333 GCCCTTGGGGAGTCTGAGGCGGG + Intergenic
1063372928 10:5533426-5533448 TCTCCAGACCAGCCTGAGGCCGG - Intergenic
1065210472 10:23397638-23397660 TCCTCAGGGCAGGCTGAGGTGGG + Intergenic
1065711844 10:28525636-28525658 TCCCTCAGGGAGGCTGAGGCAGG - Intergenic
1068817209 10:61330835-61330857 TCACCAAGACAGCCTGAGGCGGG - Intergenic
1069534830 10:69245456-69245478 CCCCTATGGGAGGCTGAGGCAGG + Intronic
1069631075 10:69897349-69897371 TCCCTGGGGAAGCCACAGGCTGG - Intronic
1069756225 10:70775797-70775819 CCCAGAGGGCAGCCTGAGGCGGG + Intronic
1069756260 10:70776009-70776031 TCCCTAGGCCAGACTGCTGCTGG + Intronic
1069782841 10:70967721-70967743 TCCCCAGGGCAACCTCATGCAGG + Intergenic
1069880365 10:71588925-71588947 TCCCAAGTGCAGCCTGCAGCAGG - Intronic
1071099998 10:82024937-82024959 TTCCTTGATCAGCCTGAGGCTGG + Intronic
1071308174 10:84318394-84318416 TCCCTTTGGGAGGCTGAGGCAGG + Intergenic
1071498513 10:86187567-86187589 TCCCAGGAGCAGCCAGAGGCTGG + Intronic
1071564040 10:86662473-86662495 GCCCCAGGGCTGCCTGAGGAAGG - Intronic
1071572869 10:86707691-86707713 TCCATGGTGCAGCCTGAGGTGGG + Intronic
1072804371 10:98415289-98415311 GCCCCAGGGCAGCAGGAGGCTGG - Intergenic
1072895729 10:99365046-99365068 TCCCCAGAGCGGGCTGAGGCAGG - Intronic
1074392838 10:113072299-113072321 TCCCTTTGGAAGGCTGAGGCGGG - Intronic
1075795510 10:125116901-125116923 TGCCTACAGCAGCATGAGGCAGG + Intronic
1077662541 11:4082612-4082634 TCCCCATGGCAGCCTGGGGCTGG - Intronic
1078217615 11:9324901-9324923 GCCCTTTGGGAGCCTGAGGCGGG + Intergenic
1079716135 11:23748151-23748173 GCCCTTTGGGAGCCTGAGGCGGG + Intergenic
1081538711 11:44014690-44014712 ACCCTAGGGCAGCCCCTGGCAGG + Intergenic
1083158864 11:60842365-60842387 CCCCAAGGGCAGCCAGAGCCAGG + Exonic
1083609797 11:63999392-63999414 TCACAGGGGTAGCCTGAGGCGGG + Exonic
1083619560 11:64042230-64042252 TCCCTGAGCCAGCCTGAGCCAGG + Intronic
1083670816 11:64299205-64299227 TCCTTGGGGCTGGCTGAGGCTGG + Intronic
1084209839 11:67615831-67615853 TGCCCAGGGCAGCTAGAGGCAGG + Intergenic
1084259614 11:67967259-67967281 TCCCTTTGGGAGGCTGAGGCAGG - Intergenic
1084959780 11:72710317-72710339 GCCCTAGGTCAGCCTGGGGCAGG + Intronic
1085039569 11:73318920-73318942 TCTCCAGGGCCGCCAGAGGCGGG - Intronic
1086180202 11:83941638-83941660 TCACTTGGGGAGGCTGAGGCCGG - Intronic
1086290767 11:85306680-85306702 TACTTAGGGGAGGCTGAGGCAGG - Intronic
1086832504 11:91583201-91583223 TCCCCTTGGGAGCCTGAGGCAGG - Intergenic
1087774237 11:102243085-102243107 TGCCCAGGGCAGCCTGAGCAGGG + Intergenic
1088605102 11:111522041-111522063 TCCCTATGGAACTCTGAGGCTGG - Intronic
1089258217 11:117205372-117205394 TCACTAGGGAATCCTGCGGCAGG - Exonic
1089318395 11:117607611-117607633 TCCCCAGTGAAGGCTGAGGCAGG + Intronic
1089396418 11:118138957-118138979 ACCGTAGGGAAGCCTGAGGGAGG - Intronic
1090349044 11:126095404-126095426 GCCCCAGGGCAGCCTGAAGGAGG + Intergenic
1091433984 12:459826-459848 TCCCTAGGGGAGCGAGAGGTGGG - Intergenic
1091921451 12:4308126-4308148 TCCCCAGGGCAGCCTGGGGAAGG + Intergenic
1091986599 12:4914741-4914763 TCCCTTTGACAGCCTGACGCTGG + Exonic
1092039500 12:5371516-5371538 TCCCTAGGGGAAACAGAGGCAGG - Intergenic
1094222531 12:28009612-28009634 GCACTTGGGGAGCCTGAGGCAGG + Intergenic
1094270824 12:28612295-28612317 TCCCTATGGAAGCCTAAGGCAGG + Intergenic
1095783520 12:46086269-46086291 TCCCTAGGGCAGCCTAGAGGGGG + Intergenic
1096939313 12:55324956-55324978 GCACTAGGGGAGGCTGAGGCGGG + Intergenic
1097915014 12:65012070-65012092 ACCATAGGGCTGCATGAGGCTGG + Intergenic
1100078866 12:90824005-90824027 TCTCTGGGGCTGGCTGAGGCCGG + Intergenic
1100198949 12:92278141-92278163 TCCCTAGGACTGCCCTAGGCAGG - Intergenic
1100206890 12:92359675-92359697 TCTCTCAAGCAGCCTGAGGCTGG + Intergenic
1100319650 12:93478357-93478379 TTACTTGGGCAGACTGAGGCAGG - Intronic
1100511174 12:95275472-95275494 TGCCTATGGGAGGCTGAGGCAGG + Intronic
1101110300 12:101480061-101480083 TCCCTTTGGGAGGCTGAGGCTGG - Intronic
1102375396 12:112417902-112417924 TCCCTTTGGGAGGCTGAGGCGGG - Intronic
1103305698 12:119962379-119962401 TTCCTAGGGCAGCCTGCATCTGG - Intergenic
1105052066 12:133063597-133063619 TTCCCAGGGCAGCCTGAGTCTGG - Intergenic
1105695383 13:22883544-22883566 TCCCTCAGGCAGGCTGAGGCAGG - Intergenic
1106028029 13:25973753-25973775 TCGCTGAGCCAGCCTGAGGCAGG + Intronic
1106163327 13:27219706-27219728 TCTCTGGGGCTGGCTGAGGCCGG + Intergenic
1106463321 13:29991391-29991413 TCCCTAGGGGAGCATAAGGAAGG + Intergenic
1106742472 13:32660445-32660467 TCCCTAGGGCATTCTGTGGCTGG - Intronic
1108555006 13:51583878-51583900 TCCCTCCGGCAGCCTGGGCCTGG + Intergenic
1108818458 13:54317830-54317852 TCTCTGGGGCTGGCTGAGGCTGG + Intergenic
1110654246 13:77977622-77977644 TCCCTTTGGGAGTCTGAGGCGGG - Intergenic
1111041816 13:82758134-82758156 TCCAGAGATCAGCCTGAGGCAGG + Intergenic
1111103308 13:83613813-83613835 TCTCTGGGGCTGGCTGAGGCTGG - Intergenic
1113523115 13:110954429-110954451 TCCCCAGGGCAGATTGGGGCAGG + Intergenic
1113636615 13:111923327-111923349 TGCCTCGTGCAGCCTGAGGGTGG - Intergenic
1114297532 14:21343177-21343199 TCCCTAAGGAAGCCTAGGGCAGG + Exonic
1114776788 14:25493069-25493091 TCCCTTTGGGAGACTGAGGCGGG + Intergenic
1115445696 14:33486738-33486760 TCCCCAGGCCTGCCTGAGGAGGG - Intronic
1116974569 14:51101470-51101492 TCCCAAGGGGACCCTGAGGTAGG + Intergenic
1118443444 14:65831585-65831607 GCCCTACGGCAGCCTGATGAAGG - Intergenic
1118589565 14:67391397-67391419 CCCCTAGGGGAGCTTGAGGAGGG - Intronic
1118745768 14:68771929-68771951 TCTGTAGGGCAGGCAGAGGCAGG - Intergenic
1122512371 14:102279952-102279974 TCACTTGGGCAGCATGAGGTTGG - Intronic
1124351116 15:28956226-28956248 TCTCTAGGGCAGGCAGGGGCTGG + Intronic
1124441625 15:29689725-29689747 TCCTTAGGGAACACTGAGGCAGG - Intergenic
1125632872 15:41162322-41162344 TACCCAGGGCAGAATGAGGCAGG + Intergenic
1127532924 15:59862774-59862796 TCTCTAGGGCTTGCTGAGGCGGG + Intergenic
1127791898 15:62405653-62405675 TCCCTAGGTGAGGCTGAGACTGG + Intronic
1128229607 15:66025370-66025392 CCCCTCAGTCAGCCTGAGGCAGG + Intronic
1129169016 15:73796712-73796734 ACCAGAGGGCAGCCTGAGCCTGG + Intergenic
1129266836 15:74397704-74397726 GGCCTGGGGCAGCATGAGGCTGG - Intergenic
1129455262 15:75673344-75673366 GCCCCAGGCCAGCCTGAGGCAGG - Intergenic
1129772826 15:78213577-78213599 GCCCTAGGGCAGGCTGGGGCGGG - Intronic
1130696808 15:86139529-86139551 TCCCTTTGGGAGGCTGAGGCAGG + Intergenic
1130849745 15:87781272-87781294 TTCCTAGCCCAGCATGAGGCAGG + Intergenic
1131129097 15:89883623-89883645 ACCCTTTGGGAGCCTGAGGCAGG - Intronic
1131243028 15:90764594-90764616 TCACTTTGGGAGCCTGAGGCAGG - Intronic
1132458515 16:37578-37600 TTCCTGGGGTAGCCAGAGGCTGG + Intergenic
1132620848 16:867720-867742 TCCCCTGGACTGCCTGAGGCCGG + Intronic
1132756368 16:1487381-1487403 ACCCGATGGCTGCCTGAGGCTGG + Exonic
1133036206 16:3035693-3035715 TCCCTGGGGTAAACTGAGGCAGG + Intronic
1133164844 16:3939108-3939130 TCCCGAGGGCGGCCAGAGGCTGG + Intergenic
1133248337 16:4463881-4463903 TCCCGAGGGCAGACAGGGGCAGG + Intronic
1133982102 16:10640623-10640645 TGCCTAGGGTAGGCGGAGGCAGG - Intronic
1135169838 16:20174034-20174056 GCCCTATGGGAGACTGAGGCAGG - Intergenic
1137571383 16:49568454-49568476 TCCCTAGACCAGCTGGAGGCAGG + Intronic
1138336001 16:56253184-56253206 TCCCCAGGGCAGCCTGGCTCTGG + Intronic
1139671826 16:68497431-68497453 AGCCCAGGGCAGCCTGGGGCAGG + Intergenic
1139700138 16:68703203-68703225 TCCCTAGAGAGGCCTGAGGAGGG + Intronic
1142279307 16:89139374-89139396 CCCCTGGGGCTTCCTGAGGCGGG + Intronic
1142499997 17:326939-326961 GCCCTGGGGCAGCTTGGGGCTGG + Intronic
1142685516 17:1575117-1575139 TTCCTCAGGCAGCCTCAGGCTGG + Exonic
1142759807 17:2035712-2035734 TCCCTCCTGCAGCCTGAGCCTGG + Intronic
1142814460 17:2414456-2414478 ACCCTAGGGGAGCAAGAGGCAGG - Intronic
1142866745 17:2796059-2796081 TCCCGAGGGCTGCCTGAGACAGG - Intronic
1143354483 17:6315822-6315844 TCTCTTTGGCAGCCTGAGGCAGG + Intergenic
1143358199 17:6346710-6346732 TTCCTAGCACAGCCTGGGGCAGG + Intergenic
1143665389 17:8355523-8355545 GCCATGGGGCAGGCTGAGGCAGG + Intergenic
1145101412 17:20080830-20080852 TCCCTTGGCCATCCTGAGGAGGG + Intronic
1146377277 17:32303180-32303202 GCCCCAGGGCAGCCCCAGGCAGG - Intronic
1149368080 17:55965572-55965594 TTCCTAGGGTAGCCTACGGCAGG + Intergenic
1149401623 17:56302276-56302298 TTCCTTGGGGAGCCTGAGGCAGG + Intronic
1150289148 17:63971689-63971711 GCCCCAGGACATCCTGAGGCTGG - Intronic
1150345340 17:64400292-64400314 GCACTTGGGGAGCCTGAGGCAGG + Intronic
1150350611 17:64441549-64441571 CCCCTTTGGCAGGCTGAGGCTGG - Intergenic
1150435091 17:65147472-65147494 TCACTCAGGCAGCCTGAAGCTGG - Intronic
1151481946 17:74374797-74374819 TCTGTAGGGCAGGCTCAGGCTGG - Intergenic
1151726378 17:75887236-75887258 TCCCTTTGGGAGGCTGAGGCAGG + Intronic
1151827043 17:76529436-76529458 TCCCTAGGGCAGGGTGGGGAGGG + Intronic
1152715026 17:81895295-81895317 TCCCTTTGGGAGGCTGAGGCGGG - Intronic
1152928602 17:83099084-83099106 TCCCGAGGGCAGCCAGGGCCGGG - Intergenic
1155277074 18:24198796-24198818 TCCCGAGGGCAACCTGAGCTGGG + Intronic
1157570124 18:48706656-48706678 ACTCCAGGGCAGGCTGAGGCTGG - Intronic
1159240217 18:65732667-65732689 GCACTTTGGCAGCCTGAGGCAGG + Intergenic
1160505503 18:79424109-79424131 TCCCTGGGGCAGGCTGTGGGAGG + Intronic
1160533905 18:79581065-79581087 TCCTGAGGGCTGCCTGTGGCAGG - Intergenic
1160596205 18:79976135-79976157 ACGCTTTGGCAGCCTGAGGCGGG + Intronic
1161009650 19:1954143-1954165 GGCCTAGGTCAGCCTGAGGTTGG + Intronic
1161740801 19:6019991-6020013 TCCCTTGGTCATTCTGAGGCTGG + Intronic
1162461465 19:10816508-10816530 TTCCTAGAGGTGCCTGAGGCGGG - Intronic
1162515036 19:11142666-11142688 TGCCCAGGACAGCCTGAGGCCGG - Intronic
1162707219 19:12564135-12564157 TCTCTAGGGCAGTCTCTGGCTGG + Intronic
1163062088 19:14768227-14768249 TCCCCAGGGGAGCATGAGTCTGG + Intronic
1163495605 19:17644936-17644958 TCACTATGGGAGGCTGAGGCAGG - Intronic
1163728531 19:18936388-18936410 TCACTTTGGGAGCCTGAGGCAGG + Intronic
1164212278 19:23109657-23109679 GCACTTGGGGAGCCTGAGGCGGG - Intronic
1164590963 19:29506694-29506716 ACCCCAGGGCAGCCCAAGGCAGG + Intergenic
1164740493 19:30572218-30572240 TCCCTACTGCTTCCTGAGGCTGG + Intronic
1164753193 19:30670976-30670998 TCTCAGGGGAAGCCTGAGGCTGG - Intronic
1165348464 19:35263740-35263762 TCACTTTGGGAGCCTGAGGCAGG - Intronic
1165392193 19:35545230-35545252 TCCCCCGGGCAGCCAGATGCTGG - Exonic
1165926932 19:39332412-39332434 GCCCTTTGGGAGCCTGAGGCGGG - Intronic
1166060862 19:40324606-40324628 TCCCTTTGGGAGGCTGAGGCAGG + Intronic
1167011749 19:46813329-46813351 TCCCCACGGTAGCCCGAGGCTGG - Intergenic
1167093706 19:47362036-47362058 TCACTTTGGGAGCCTGAGGCAGG + Intronic
1167427566 19:49437296-49437318 TCCCTAGGGATGCCTGGGACGGG - Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1202712015 1_KI270714v1_random:24039-24061 GCCCCAGAGCAGCCTGAGCCAGG - Intergenic
925430180 2:3785351-3785373 GCCCTAGGGCAGCGTGTGGCTGG + Intronic
925624776 2:5831919-5831941 TGCCTAGGGAAGCCTGAGAATGG + Intergenic
926800631 2:16656993-16657015 TCCAGAGGTCAGCCTGGGGCTGG + Intronic
927209894 2:20632650-20632672 GTCCTGGGGGAGCCTGAGGCGGG + Intronic
929467938 2:42162620-42162642 TCCCTTTGGAAGGCTGAGGCAGG + Intergenic
929822925 2:45287866-45287888 TCACTAGGCCTCCCTGAGGCGGG - Intergenic
931383430 2:61774953-61774975 TCCCTTTGGGAGGCTGAGGCAGG - Intergenic
932224618 2:70029808-70029830 TCCCTAGAGGAGGCTGAGGAGGG + Intergenic
932247218 2:70205805-70205827 GCCCTTGGGGAGGCTGAGGCAGG + Intronic
933797234 2:85929303-85929325 TCTCTGGGGCTGGCTGAGGCCGG - Intergenic
935677653 2:105609685-105609707 CCCCTGGGGCAGCCTGAGCCTGG - Intergenic
936001796 2:108839272-108839294 TCCCTAAGGCAGCTAGATGCTGG + Exonic
936439240 2:112536315-112536337 TGCTTAGGGGAGACTGAGGCAGG - Exonic
937267146 2:120623706-120623728 TCCCTACTGCAGTCTGTGGCTGG - Intergenic
937326330 2:120991579-120991601 TCCCTAGGGCAGCCTGAGGCTGG - Exonic
938135071 2:128750118-128750140 GCACTTTGGCAGCCTGAGGCAGG + Intergenic
939067651 2:137503913-137503935 TACCTGGGGGAGGCTGAGGCAGG + Intronic
939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG + Intergenic
941203956 2:162548292-162548314 TCCCTAAGGCTGCCAGAGGCAGG + Intronic
942247825 2:174023913-174023935 GCCCCAGGGAAGCCAGAGGCCGG - Intergenic
944237086 2:197450653-197450675 TCCCTGGGGCTGGCCGAGGCAGG + Intergenic
946986782 2:225282296-225282318 GCACTATGGAAGCCTGAGGCAGG + Intergenic
947122819 2:226835590-226835612 GCCCCAGCGCAGCCGGAGGCTGG - Intronic
947433732 2:230054067-230054089 TCCCAGGTGCAGCCTGAGGTGGG + Intronic
947797196 2:232901947-232901969 TGCCGAGGACAGACTGAGGCCGG - Intronic
948149869 2:235736606-235736628 TCCCTTTGGGAGGCTGAGGCAGG + Intronic
948681464 2:239637980-239638002 TCCTTAGGGGAGCCTGGGGTGGG - Intergenic
948811027 2:240478518-240478540 TCCCAGGGGCAGCCTGTGGCTGG + Intergenic
1169095048 20:2890141-2890163 GCACTTGGGCAGGCTGAGGCGGG - Intronic
1169273341 20:4217117-4217139 TCCCCAGGGCTGCTTGGGGCTGG - Intergenic
1169342459 20:4806554-4806576 TCCCTTCGGGAGGCTGAGGCGGG - Intronic
1169433713 20:5564579-5564601 ACCCTTGGGGAGGCTGAGGCTGG + Intronic
1169443659 20:5653735-5653757 TTACTAGGGGAGGCTGAGGCAGG - Intergenic
1169769656 20:9187084-9187106 TCCCTCAGGGAGGCTGAGGCAGG - Intronic
1169940664 20:10933698-10933720 TCCTTAGGGGACTCTGAGGCAGG + Intergenic
1170076874 20:12429211-12429233 GCCCTTGGGGAGGCTGAGGCAGG + Intergenic
1171934161 20:31257738-31257760 TACCTGGGGCAGTCTGAGCCAGG - Exonic
1172123609 20:32612544-32612566 TTGTTAAGGCAGCCTGAGGCGGG - Intergenic
1173985727 20:47259957-47259979 TCAATAGGGCAGCTGGAGGCAGG - Intronic
1174109543 20:48188906-48188928 TCCCTTTGGGAGGCTGAGGCAGG - Intergenic
1175918790 20:62440285-62440307 TCGCTGGAGCAGACTGAGGCTGG + Intergenic
1176145929 20:63565464-63565486 TCCGTAGCGCAGCCGGGGGCAGG + Exonic
1177379860 21:20326219-20326241 GCACTTTGGCAGCCTGAGGCAGG + Intergenic
1177812366 21:25938018-25938040 GCCCTATGGGAGGCTGAGGCAGG - Intronic
1178001841 21:28169387-28169409 TCCCTTTGGGAGGCTGAGGCGGG + Intergenic
1178740909 21:35200254-35200276 GCCCTTGGGGAGGCTGAGGCAGG - Intronic
1179340562 21:40504409-40504431 TCCCGAGGGAGGGCTGAGGCAGG - Intronic
1179596135 21:42444298-42444320 TTCCTAGGCCTCCCTGAGGCTGG + Intronic
1179719289 21:43306260-43306282 TCCGTAGGGCAGCTGGAGGGGGG + Intergenic
1179793252 21:43767851-43767873 TCCGTAGGGAAACCTGAGGCAGG - Intergenic
1180028262 21:45181302-45181324 TTCCTAGGGCAGCAAGAGGTGGG - Intronic
1181305957 22:21917409-21917431 GTCCTAGGGCTGCCTGAGCCCGG - Intergenic
1181368419 22:22397760-22397782 TCCCCAGGGCAGCCTGTTCCTGG - Intergenic
1181372075 22:22426550-22426572 TTCCTAGGGCAGCCTGTTCCAGG - Intergenic
1182901829 22:33904653-33904675 ACCCGAGGGCAGCGTCAGGCAGG - Intronic
1183286391 22:36967014-36967036 CCCCTAGGGCTGGCTGAGGTTGG + Intergenic
1183450396 22:37891226-37891248 TCACTATGGGAGGCTGAGGCAGG - Intergenic
1183984944 22:41564369-41564391 TCACTGGGGAGGCCTGAGGCCGG - Intronic
1184732101 22:46376614-46376636 TCCCTTTGGGAGGCTGAGGCAGG - Intronic
1184771286 22:46598226-46598248 TCCCTTTGGGAGGCTGAGGCGGG - Intronic
1185137193 22:49079735-49079757 TGCCTAGGGGAGCCTCTGGCCGG - Intergenic
1185207198 22:49546801-49546823 ACCCAAGGGCAGCCTGGGGCTGG + Intronic
949892263 3:8742118-8742140 TGCCTAGAGCTGCCTGAGCCGGG + Intronic
950203114 3:11058565-11058587 ATCCTAGGGGAGACTGAGGCAGG + Intergenic
950885425 3:16358339-16358361 TCCCCAGTGCATCCTGACGCTGG - Intronic
950954513 3:17037205-17037227 TCCCAAGGTCATCCTGAGCCTGG + Intronic
952241377 3:31533492-31533514 TGCCCCGTGCAGCCTGAGGCGGG + Intronic
953350256 3:42210038-42210060 CCTCTGGGGAAGCCTGAGGCCGG - Intronic
954457576 3:50608224-50608246 TCTCTAGGGAAGCGTGAAGCTGG - Intronic
954682865 3:52355349-52355371 TCCCCAGGGCTGCCTGAGCTTGG + Intronic
954723391 3:52585638-52585660 TCCCAACGGGAGGCTGAGGCAGG - Intronic
955084464 3:55689133-55689155 TCACTAGGACACGCTGAGGCAGG + Intronic
955414589 3:58680386-58680408 TCCCAGGGGCAGCCTGAGGGTGG + Intergenic
955816943 3:62853712-62853734 GCCCTTTGGGAGCCTGAGGCAGG + Intronic
956428862 3:69164570-69164592 AGCCTAGGGCAGCCTGCAGCTGG - Intergenic
957737887 3:84225851-84225873 TCCTTAGGGCAACCTGAAGGGGG + Intergenic
960932716 3:122870458-122870480 TCCCTTTGGGAGGCTGAGGCAGG - Intronic
961209840 3:125117214-125117236 TGCCTGGGGCAACCTGGGGCAGG - Intronic
961484261 3:127206530-127206552 CCCCTAGGACACCCTGAGGATGG + Intergenic
961546732 3:127639403-127639425 TCGCTGGGGAAGCCTGAGCCAGG - Exonic
962206522 3:133439551-133439573 TACCTAGCACAGCCTGAGCCAGG + Intronic
962840009 3:139224725-139224747 TTCCTAATGCAGCCTGGGGCAGG + Intronic
964448563 3:156786974-156786996 TCCCTCTGGGAGGCTGAGGCAGG - Intergenic
964726415 3:159818567-159818589 ACCGTAGGGAAGCCTGGGGCAGG + Intronic
965023698 3:163269749-163269771 GCGCTTTGGCAGCCTGAGGCCGG + Intergenic
965945948 3:174241763-174241785 TCGGGAGGGGAGCCTGAGGCAGG - Intronic
966595159 3:181719433-181719455 TCCCCAGGGCAGCCGGCGGGAGG - Intergenic
966769454 3:183491357-183491379 GCCCTATGGGAGGCTGAGGCGGG - Exonic
966819643 3:183914701-183914723 GCCCTGGGGCAGCCTCAGGCGGG - Intergenic
967919527 3:194604098-194604120 GCACTTGGGGAGCCTGAGGCAGG - Intronic
968504433 4:965375-965397 TCCCTTGGGCAGCCCTGGGCTGG - Intronic
968626877 4:1629734-1629756 TCCCTTTGGGAGGCTGAGGCAGG + Intronic
968759061 4:2432792-2432814 ACCCTTGGGCAGCCACAGGCCGG + Intronic
968986879 4:3880419-3880441 GCCCTGGGGCTGCCTGAGGAGGG + Intergenic
969258475 4:6019187-6019209 TCCTTTGGGCACCCTGAGGAGGG + Intergenic
969662917 4:8540841-8540863 TGCCTGGGGCCGCCAGAGGCTGG - Intergenic
969675072 4:8610108-8610130 TCCCAAGGGCTTCCTGGGGCAGG + Intronic
970232050 4:13920971-13920993 TCCCAGGAGGAGCCTGAGGCAGG - Intergenic
970592547 4:17572007-17572029 TACCTGGGGGAGGCTGAGGCAGG + Intergenic
970853206 4:20626308-20626330 TTCCTAGGGCAGTCTGATGCAGG + Intergenic
972591852 4:40495353-40495375 TCCCCTTGGGAGCCTGAGGCAGG + Intronic
972598999 4:40555181-40555203 TCCCTTTGGGAGTCTGAGGCGGG - Intronic
975671942 4:76788690-76788712 TCCGTTGGGAAGGCTGAGGCAGG + Intergenic
976124404 4:81818325-81818347 TCCTTAGGACTTCCTGAGGCTGG - Intronic
978086250 4:104659000-104659022 TCACTTGGGAAGACTGAGGCTGG - Intergenic
978611187 4:110542325-110542347 TCACCAGGGCAGCCTGGGGAGGG - Intronic
979300872 4:119085814-119085836 GCCCTTTGGGAGCCTGAGGCAGG + Intergenic
979359989 4:119750629-119750651 TCTCGCTGGCAGCCTGAGGCAGG - Intergenic
984676681 4:182556841-182556863 TACCTAGTTCAGCCTGAGTCAGG - Intronic
985367405 4:189245996-189246018 TACAGAGGGCAGCCTGAAGCAGG - Intergenic
985423592 4:189807304-189807326 TCTCTGGGGCTGGCTGAGGCTGG - Intergenic
985796191 5:1963964-1963986 TGCCAAGGGCAGCAGGAGGCAGG - Intergenic
987104944 5:14629337-14629359 TCACTTTGGGAGCCTGAGGCAGG - Intergenic
987923656 5:24314254-24314276 TCTCTGGGGCTGTCTGAGGCTGG + Intergenic
988288296 5:29250721-29250743 GCCCTTTGGGAGCCTGAGGCGGG + Intergenic
992246778 5:74833794-74833816 TCCCTAGAGCAGCTGGAGCCAGG - Intronic
992295689 5:75324351-75324373 TCCCTATGCCACCCTCAGGCTGG + Intergenic
992941257 5:81764596-81764618 TCCCTGGGGCAGCTTGCAGCTGG - Intergenic
995482593 5:112608059-112608081 TCCTTAGGGCAACCTGAAGGGGG - Intergenic
996539434 5:124613632-124613654 GCCCTTGGGCAGGCTGAGGCAGG - Intergenic
996681140 5:126229047-126229069 TCTCTGGGGCTGGCTGAGGCTGG + Intergenic
997602456 5:135149907-135149929 TCCCCAGAGCTGCCTCAGGCAGG - Intronic
997653769 5:135540443-135540465 TCCCTAGGGCTGCCTGGAACAGG - Intergenic
998176657 5:139905485-139905507 TCCTTAGGAGAGCCTGAAGCAGG + Intronic
999257406 5:150217218-150217240 TCCCTGGGGCATGCTGTGGCTGG - Intronic
999311066 5:150552597-150552619 GCACTATGGCAGGCTGAGGCGGG - Intronic
1000254516 5:159525256-159525278 CCCCTGGGGCTGCCTGAGGATGG + Intergenic
1000288197 5:159846188-159846210 TCCCTTGGGGACCCTGAGGCTGG - Intergenic
1001160833 5:169311287-169311309 TCCATAGCTCAGCCTAAGGCGGG - Intergenic
1001429850 5:171650641-171650663 TCCCTAGGGCAGCGGGTGGAGGG - Intergenic
1001619797 5:173074054-173074076 TCCCTTTGGGAGGCTGAGGCGGG + Intronic
1002073206 5:176692878-176692900 GCCCTAGGGGAGGATGAGGCAGG - Intergenic
1002113865 5:176942089-176942111 TCCCTTTGGGAGGCTGAGGCGGG - Intronic
1002300513 5:178255014-178255036 GGCCTGGGGCACCCTGAGGCAGG + Exonic
1002790395 6:433422-433444 GCCCCAGGGCAGCATGAGGAGGG + Intergenic
1003310855 6:4968789-4968811 GCCCTATGGGAGGCTGAGGCAGG + Intergenic
1003508297 6:6758316-6758338 TCTTTAAGGCAACCTGAGGCTGG + Intergenic
1004289691 6:14355079-14355101 TCCCTAGGTCAGGGTGTGGCTGG - Intergenic
1004696477 6:18038595-18038617 TCACTATGGGAGTCTGAGGCTGG - Intergenic
1005935495 6:30517912-30517934 TCTCTGGGGCTGGCTGAGGCCGG + Intergenic
1006136539 6:31899575-31899597 TCCCCTGGGCAGCCTTAGCCAGG + Intronic
1006195214 6:32236244-32236266 TCCCTTTGGGAGGCTGAGGCAGG + Intergenic
1006563421 6:34933614-34933636 TCCCTTTGGGAGGCTGAGGCGGG - Intronic
1006731742 6:36241394-36241416 ACCCTTTGGGAGCCTGAGGCCGG - Intergenic
1007179077 6:39915537-39915559 TACCTTGGGCCTCCTGAGGCAGG + Intronic
1007410057 6:41656415-41656437 ACCCCTGGCCAGCCTGAGGCTGG + Intergenic
1007713304 6:43838497-43838519 CCCCAGGGGCAGCCTGGGGCTGG - Intergenic
1013304845 6:108838503-108838525 CCCCTAGGGCACTCTGAGGTGGG - Intergenic
1013420647 6:109963660-109963682 TCCCAAGGCCTGCCTGAGGTAGG + Intergenic
1013514101 6:110869995-110870017 TCCCTTTGGGAGGCTGAGGCGGG - Intronic
1013749330 6:113384419-113384441 ACCCTTGGGAAGGCTGAGGCAGG - Intergenic
1016183476 6:141175038-141175060 TCTCTGGGGCTGGCTGAGGCTGG + Intergenic
1017040813 6:150307427-150307449 ACCCTAGGCCAGGCTGTGGCTGG - Intergenic
1017815656 6:158014774-158014796 TCGCTAGAGGAGCATGAGGCAGG + Intronic
1019031516 6:169017984-169018006 TCCCCAGGGCTCCCTCAGGCAGG + Intergenic
1019881403 7:3864643-3864665 TCCCCAGGGCTGTCTGAGACTGG - Intronic
1019972074 7:4549316-4549338 ACACTTGGGGAGCCTGAGGCAGG + Intergenic
1020241626 7:6399573-6399595 ACTCTAGGGCAGCGTGAGGGTGG + Intronic
1020265981 7:6560347-6560369 TACTTAGGGCAGCCTGGGGAGGG - Intergenic
1020687305 7:11311482-11311504 TCCCTAGGGAAGTCTGGGACAGG - Intergenic
1020778209 7:12483621-12483643 GCCCTTTGGAAGCCTGAGGCGGG + Intergenic
1022578043 7:31517727-31517749 TCTCTGGGGCTGGCTGAGGCCGG - Intronic
1023768894 7:43536745-43536767 TCCCTAGGGCAGCCAGGGCCTGG - Intronic
1024294999 7:47834597-47834619 TCCTTAGGGCAGCCTCAAGTGGG - Intronic
1025982167 7:66415487-66415509 GCCCTTTGGCAGGCTGAGGCCGG - Intronic
1027055859 7:75048810-75048832 TCCCTGGGCGAGCCTGAAGCTGG - Intronic
1028217119 7:88147264-88147286 CTCCTAGGGCAGCCAGAGGCAGG + Intronic
1028594834 7:92537328-92537350 TCCCTTTGGGAGGCTGAGGCAGG - Exonic
1029590653 7:101504646-101504668 TCTCCAGGGCACCCAGAGGCTGG + Intronic
1030638601 7:111978476-111978498 GCACTTGGGCAGACTGAGGCAGG - Intronic
1031484344 7:122310288-122310310 TCCCCTGGGCAGCCGGGGGCAGG - Intronic
1031844088 7:126783198-126783220 TCCCTATGGAAGACTGGGGCCGG + Intronic
1032094552 7:128931410-128931432 TCCCTGGGGCAGGCAGAGCCAGG - Intergenic
1032267583 7:130380018-130380040 TCCCCAAGGCAGCTTCAGGCAGG - Intergenic
1032365232 7:131292625-131292647 TGCCTAGGGCTACCAGAGGCTGG + Intronic
1032715708 7:134507479-134507501 TCCCTGGGCCATCCTGAGCCTGG + Intergenic
1033340409 7:140487711-140487733 GCCCTTTGGCAGGCTGAGGCAGG + Intergenic
1035724844 8:1817951-1817973 ACCCTGGGGCAGCGTGGGGCTGG - Intergenic
1035832385 8:2710841-2710863 TTCCTAGGGCAGTGTGGGGCGGG - Intergenic
1036656683 8:10681562-10681584 TGCCAAGGGAAGCCTGAAGCAGG - Intronic
1036849418 8:12191292-12191314 TGCCAAGGTCAGCCTGTGGCTGG + Intronic
1036870780 8:12433565-12433587 TGCCAAGGTCAGCCTGTGGCTGG + Intronic
1037882449 8:22579682-22579704 TCCCCAGGGCAGCCCCAGGATGG + Intronic
1038209168 8:25499413-25499435 CTACTAGGGAAGCCTGAGGCAGG - Intronic
1039502995 8:38031426-38031448 TCCTGAGGGCAGCCCGAGGCTGG - Intronic
1042852614 8:73231586-73231608 TTCCTAGGGAAGACTGGGGCAGG + Intergenic
1043346769 8:79307156-79307178 TCACTGGGGCAGCCTCAGGCTGG + Intergenic
1045029791 8:98124161-98124183 GCCCTGGGGCAGCCTCATGCAGG + Intronic
1046465312 8:114594231-114594253 GCCCTTTGGGAGCCTGAGGCGGG + Intergenic
1047220167 8:122912316-122912338 TGCCCAGGCCAGCCTGTGGCTGG - Intronic
1047688775 8:127329561-127329583 TCACTTGGGGAGGCTGAGGCAGG + Intergenic
1049494332 8:142922637-142922659 GCCCTGGGGCACCCTGATGCAGG + Intergenic
1049579954 8:143406718-143406740 TGCCCAGGCCAGCCTGAGGCAGG - Intergenic
1049630799 8:143655555-143655577 TCCCTTTGGGAGGCTGAGGCAGG - Exonic
1049632829 8:143668128-143668150 TCTCTGGGGCAGGCTGAGGCTGG - Intergenic
1049785804 8:144450151-144450173 TTCCGAGGGCCGCCAGAGGCTGG - Exonic
1050107085 9:2176802-2176824 GCCCTATGGGAGGCTGAGGCAGG - Intronic
1053651934 9:40177639-40177661 TCCCACGGGCTTCCTGAGGCCGG - Intergenic
1053902325 9:42806952-42806974 TCCCACGGGCTTCCTGAGGCCGG - Intergenic
1054532651 9:66198567-66198589 TCCCACGGGCTTCCTGAGGCCGG + Intergenic
1054648892 9:67611045-67611067 TCCTGAGGCCAGCCTGTGGCAGG - Intergenic
1055638932 9:78304369-78304391 TCCATTGGCCAGCCTGGGGCAGG + Intronic
1056760566 9:89411793-89411815 TCCCTAGGGCAGCCAGATCTGGG + Intronic
1057497780 9:95574370-95574392 TGCCGAGGACAGCCTGAGGGTGG - Intergenic
1057497838 9:95574610-95574632 TGCCGAGGACAGCCTGAGGGTGG - Intergenic
1059497251 9:114720080-114720102 TCCCTAGGGGAGCCCAAGGCAGG + Intergenic
1060209447 9:121700811-121700833 TGCCAAGCCCAGCCTGAGGCGGG + Intronic
1061209500 9:129182644-129182666 GCACTAGGGCAGCTAGAGGCAGG - Intergenic
1061610819 9:131744491-131744513 TCCTGAGGGCTGCCTGTGGCTGG + Intergenic
1061886519 9:133593745-133593767 TCCCTGGGCCAGGATGAGGCAGG - Intergenic
1062174722 9:135154818-135154840 TCCCCAGGTCATCCTGATGCAGG + Intergenic
1062218006 9:135399531-135399553 TGCCCAGGGCACCCTGAGGGGGG + Intergenic
1186017797 X:5217869-5217891 ACCCAAGGGGAGACTGAGGCAGG + Intergenic
1187012531 X:15294615-15294637 GCCCTTTGGCAGGCTGAGGCAGG - Intronic
1188111230 X:26197882-26197904 TCCCTGTGGTAACCTGAGGCTGG - Intergenic
1190057461 X:47190006-47190028 TCACTTTGGCAGGCTGAGGCAGG - Intergenic
1190533131 X:51400191-51400213 GCCAGAGGGCAGGCTGAGGCAGG + Intergenic
1192326741 X:70139061-70139083 TCACTTTGGGAGCCTGAGGCAGG + Intronic
1193240144 X:79158686-79158708 GCACTTGGGCAGGCTGAGGCAGG - Intergenic
1196935588 X:120727462-120727484 CCCCTAGGGCAGCTTGCAGCAGG - Intergenic
1197750654 X:129961432-129961454 GCCCTAGGGCAAGCTGGGGCAGG + Intergenic
1200397876 X:156001824-156001846 TCCCTAGGGGAGCCAGAGGTTGG - Intronic
1200951000 Y:8900429-8900451 TTCCTCGGGAAGGCTGAGGCAGG + Intergenic
1201143420 Y:11047288-11047310 TCCCTTGGGGACCCTGAGGAAGG + Intergenic
1202329216 Y:23728835-23728857 GCACTATGGGAGCCTGAGGCAGG - Intergenic
1202541555 Y:25941219-25941241 GCACTATGGGAGCCTGAGGCAGG + Intergenic