ID: 937327556

View in Genome Browser
Species Human (GRCh38)
Location 2:121000464-121000486
Sequence GGGACACAGGACCACTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937327556_937327561 9 Left 937327556 2:121000464-121000486 CCATCACAGTGGTCCTGTGTCCC No data
Right 937327561 2:121000496-121000518 TGTGGCTGATAACATGACCATGG No data
937327556_937327562 13 Left 937327556 2:121000464-121000486 CCATCACAGTGGTCCTGTGTCCC No data
Right 937327562 2:121000500-121000522 GCTGATAACATGACCATGGAAGG No data
937327556_937327565 29 Left 937327556 2:121000464-121000486 CCATCACAGTGGTCCTGTGTCCC No data
Right 937327565 2:121000516-121000538 TGGAAGGAAGGCAGCTCTGCAGG No data
937327556_937327558 -9 Left 937327556 2:121000464-121000486 CCATCACAGTGGTCCTGTGTCCC No data
Right 937327558 2:121000478-121000500 CTGTGTCCCTGCTTAAGCTGTGG No data
937327556_937327563 17 Left 937327556 2:121000464-121000486 CCATCACAGTGGTCCTGTGTCCC No data
Right 937327563 2:121000504-121000526 ATAACATGACCATGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937327556 Original CRISPR GGGACACAGGACCACTGTGA TGG (reversed) Intergenic
No off target data available for this crispr