ID: 937329703

View in Genome Browser
Species Human (GRCh38)
Location 2:121018938-121018960
Sequence CACGCCCGCAGCAGCCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937329700_937329703 5 Left 937329700 2:121018910-121018932 CCCTTCCGGGTGAGTGGGATTTG No data
Right 937329703 2:121018938-121018960 CACGCCCGCAGCAGCCCCTGAGG No data
937329702_937329703 0 Left 937329702 2:121018915-121018937 CCGGGTGAGTGGGATTTGCTGCT No data
Right 937329703 2:121018938-121018960 CACGCCCGCAGCAGCCCCTGAGG No data
937329701_937329703 4 Left 937329701 2:121018911-121018933 CCTTCCGGGTGAGTGGGATTTGC No data
Right 937329703 2:121018938-121018960 CACGCCCGCAGCAGCCCCTGAGG No data
937329699_937329703 9 Left 937329699 2:121018906-121018928 CCAGCCCTTCCGGGTGAGTGGGA No data
Right 937329703 2:121018938-121018960 CACGCCCGCAGCAGCCCCTGAGG No data
937329694_937329703 24 Left 937329694 2:121018891-121018913 CCTGGCGGCTGCAGTCCAGCCCT No data
Right 937329703 2:121018938-121018960 CACGCCCGCAGCAGCCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937329703 Original CRISPR CACGCCCGCAGCAGCCCCTG AGG Intergenic
No off target data available for this crispr