ID: 937330588

View in Genome Browser
Species Human (GRCh38)
Location 2:121025883-121025905
Sequence GCTCAGGGCAGGCCCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937330580_937330588 13 Left 937330580 2:121025847-121025869 CCATGAGGTGCTGGTGTTAGGAA No data
Right 937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937330588 Original CRISPR GCTCAGGGCAGGCCCCAAGC AGG Intergenic
No off target data available for this crispr