ID: 937330876

View in Genome Browser
Species Human (GRCh38)
Location 2:121028471-121028493
Sequence ATGATATTATTGATCTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937330875_937330876 -1 Left 937330875 2:121028449-121028471 CCTAAATGTAAAACAGGAATGAA No data
Right 937330876 2:121028471-121028493 ATGATATTATTGATCTAACAAGG No data
937330872_937330876 9 Left 937330872 2:121028439-121028461 CCTCAGTTTCCCTAAATGTAAAA No data
Right 937330876 2:121028471-121028493 ATGATATTATTGATCTAACAAGG No data
937330874_937330876 0 Left 937330874 2:121028448-121028470 CCCTAAATGTAAAACAGGAATGA No data
Right 937330876 2:121028471-121028493 ATGATATTATTGATCTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937330876 Original CRISPR ATGATATTATTGATCTAACA AGG Intergenic
No off target data available for this crispr