ID: 937330876 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:121028471-121028493 |
| Sequence | ATGATATTATTGATCTAACA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937330875_937330876 | -1 | Left | 937330875 | 2:121028449-121028471 | CCTAAATGTAAAACAGGAATGAA | No data | ||
| Right | 937330876 | 2:121028471-121028493 | ATGATATTATTGATCTAACAAGG | No data | ||||
| 937330872_937330876 | 9 | Left | 937330872 | 2:121028439-121028461 | CCTCAGTTTCCCTAAATGTAAAA | No data | ||
| Right | 937330876 | 2:121028471-121028493 | ATGATATTATTGATCTAACAAGG | No data | ||||
| 937330874_937330876 | 0 | Left | 937330874 | 2:121028448-121028470 | CCCTAAATGTAAAACAGGAATGA | No data | ||
| Right | 937330876 | 2:121028471-121028493 | ATGATATTATTGATCTAACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937330876 | Original CRISPR | ATGATATTATTGATCTAACA AGG | Intergenic | ||
| No off target data available for this crispr | |||||