ID: 937331060

View in Genome Browser
Species Human (GRCh38)
Location 2:121030363-121030385
Sequence GGACCCGGAGGGGAAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937331060_937331070 17 Left 937331060 2:121030363-121030385 CCAACTTCTTCCCCTCCGGGTCC No data
Right 937331070 2:121030403-121030425 TGTCTTCTTGCATCTTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937331060 Original CRISPR GGACCCGGAGGGGAAGAAGT TGG (reversed) Intergenic