ID: 937332884

View in Genome Browser
Species Human (GRCh38)
Location 2:121043131-121043153
Sequence TCCCTAGACCCCCGGACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937332884_937332894 18 Left 937332884 2:121043131-121043153 CCAGGAGTCCGGGGGTCTAGGGA No data
Right 937332894 2:121043172-121043194 CTGCCGAAGGGCAGGTTGGGAGG No data
937332884_937332886 5 Left 937332884 2:121043131-121043153 CCAGGAGTCCGGGGGTCTAGGGA No data
Right 937332886 2:121043159-121043181 AGACCCCAGATGACTGCCGAAGG No data
937332884_937332893 15 Left 937332884 2:121043131-121043153 CCAGGAGTCCGGGGGTCTAGGGA No data
Right 937332893 2:121043169-121043191 TGACTGCCGAAGGGCAGGTTGGG No data
937332884_937332891 10 Left 937332884 2:121043131-121043153 CCAGGAGTCCGGGGGTCTAGGGA No data
Right 937332891 2:121043164-121043186 CCAGATGACTGCCGAAGGGCAGG No data
937332884_937332892 14 Left 937332884 2:121043131-121043153 CCAGGAGTCCGGGGGTCTAGGGA No data
Right 937332892 2:121043168-121043190 ATGACTGCCGAAGGGCAGGTTGG No data
937332884_937332887 6 Left 937332884 2:121043131-121043153 CCAGGAGTCCGGGGGTCTAGGGA No data
Right 937332887 2:121043160-121043182 GACCCCAGATGACTGCCGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937332884 Original CRISPR TCCCTAGACCCCCGGACTCC TGG (reversed) Intergenic
No off target data available for this crispr