ID: 937332885

View in Genome Browser
Species Human (GRCh38)
Location 2:121043139-121043161
Sequence TCTTTCTCTCCCTAGACCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937332885_937332894 10 Left 937332885 2:121043139-121043161 CCGGGGGTCTAGGGAGAGAAAGA No data
Right 937332894 2:121043172-121043194 CTGCCGAAGGGCAGGTTGGGAGG No data
937332885_937332892 6 Left 937332885 2:121043139-121043161 CCGGGGGTCTAGGGAGAGAAAGA No data
Right 937332892 2:121043168-121043190 ATGACTGCCGAAGGGCAGGTTGG No data
937332885_937332896 25 Left 937332885 2:121043139-121043161 CCGGGGGTCTAGGGAGAGAAAGA No data
Right 937332896 2:121043187-121043209 TTGGGAGGCAAGTGCAGTTGTGG No data
937332885_937332887 -2 Left 937332885 2:121043139-121043161 CCGGGGGTCTAGGGAGAGAAAGA No data
Right 937332887 2:121043160-121043182 GACCCCAGATGACTGCCGAAGGG No data
937332885_937332891 2 Left 937332885 2:121043139-121043161 CCGGGGGTCTAGGGAGAGAAAGA No data
Right 937332891 2:121043164-121043186 CCAGATGACTGCCGAAGGGCAGG No data
937332885_937332893 7 Left 937332885 2:121043139-121043161 CCGGGGGTCTAGGGAGAGAAAGA No data
Right 937332893 2:121043169-121043191 TGACTGCCGAAGGGCAGGTTGGG No data
937332885_937332886 -3 Left 937332885 2:121043139-121043161 CCGGGGGTCTAGGGAGAGAAAGA No data
Right 937332886 2:121043159-121043181 AGACCCCAGATGACTGCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937332885 Original CRISPR TCTTTCTCTCCCTAGACCCC CGG (reversed) Intergenic
No off target data available for this crispr