ID: 937332894

View in Genome Browser
Species Human (GRCh38)
Location 2:121043172-121043194
Sequence CTGCCGAAGGGCAGGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937332885_937332894 10 Left 937332885 2:121043139-121043161 CCGGGGGTCTAGGGAGAGAAAGA No data
Right 937332894 2:121043172-121043194 CTGCCGAAGGGCAGGTTGGGAGG No data
937332884_937332894 18 Left 937332884 2:121043131-121043153 CCAGGAGTCCGGGGGTCTAGGGA No data
Right 937332894 2:121043172-121043194 CTGCCGAAGGGCAGGTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937332894 Original CRISPR CTGCCGAAGGGCAGGTTGGG AGG Intergenic
No off target data available for this crispr