ID: 937333683

View in Genome Browser
Species Human (GRCh38)
Location 2:121047514-121047536
Sequence TAGCCACTCAGGAGGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937333683_937333687 -10 Left 937333683 2:121047514-121047536 CCCTGTGACCTCCTGAGTGGCTA No data
Right 937333687 2:121047527-121047549 TGAGTGGCTACTTCTTTCCTAGG No data
937333683_937333699 28 Left 937333683 2:121047514-121047536 CCCTGTGACCTCCTGAGTGGCTA No data
Right 937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG No data
937333683_937333698 27 Left 937333683 2:121047514-121047536 CCCTGTGACCTCCTGAGTGGCTA No data
Right 937333698 2:121047564-121047586 TGGAGCTCTGCCCAGGACCGGGG No data
937333683_937333697 26 Left 937333683 2:121047514-121047536 CCCTGTGACCTCCTGAGTGGCTA No data
Right 937333697 2:121047563-121047585 CTGGAGCTCTGCCCAGGACCGGG No data
937333683_937333696 25 Left 937333683 2:121047514-121047536 CCCTGTGACCTCCTGAGTGGCTA No data
Right 937333696 2:121047562-121047584 CCTGGAGCTCTGCCCAGGACCGG No data
937333683_937333692 20 Left 937333683 2:121047514-121047536 CCCTGTGACCTCCTGAGTGGCTA No data
Right 937333692 2:121047557-121047579 ACCTCCCTGGAGCTCTGCCCAGG No data
937333683_937333689 7 Left 937333683 2:121047514-121047536 CCCTGTGACCTCCTGAGTGGCTA No data
Right 937333689 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937333683 Original CRISPR TAGCCACTCAGGAGGTCACA GGG (reversed) Intergenic
No off target data available for this crispr