ID: 937333686

View in Genome Browser
Species Human (GRCh38)
Location 2:121047525-121047547
Sequence TAGGAAAGAAGTAGCCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937333686_937333699 17 Left 937333686 2:121047525-121047547 CCTGAGTGGCTACTTCTTTCCTA No data
Right 937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG No data
937333686_937333697 15 Left 937333686 2:121047525-121047547 CCTGAGTGGCTACTTCTTTCCTA No data
Right 937333697 2:121047563-121047585 CTGGAGCTCTGCCCAGGACCGGG No data
937333686_937333692 9 Left 937333686 2:121047525-121047547 CCTGAGTGGCTACTTCTTTCCTA No data
Right 937333692 2:121047557-121047579 ACCTCCCTGGAGCTCTGCCCAGG No data
937333686_937333696 14 Left 937333686 2:121047525-121047547 CCTGAGTGGCTACTTCTTTCCTA No data
Right 937333696 2:121047562-121047584 CCTGGAGCTCTGCCCAGGACCGG No data
937333686_937333702 26 Left 937333686 2:121047525-121047547 CCTGAGTGGCTACTTCTTTCCTA No data
Right 937333702 2:121047574-121047596 CCCAGGACCGGGGGCCATGGTGG No data
937333686_937333698 16 Left 937333686 2:121047525-121047547 CCTGAGTGGCTACTTCTTTCCTA No data
Right 937333698 2:121047564-121047586 TGGAGCTCTGCCCAGGACCGGGG No data
937333686_937333689 -4 Left 937333686 2:121047525-121047547 CCTGAGTGGCTACTTCTTTCCTA No data
Right 937333689 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
937333686_937333700 23 Left 937333686 2:121047525-121047547 CCTGAGTGGCTACTTCTTTCCTA No data
Right 937333700 2:121047571-121047593 CTGCCCAGGACCGGGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937333686 Original CRISPR TAGGAAAGAAGTAGCCACTC AGG (reversed) Intergenic
No off target data available for this crispr