ID: 937333688

View in Genome Browser
Species Human (GRCh38)
Location 2:121047544-121047566
Sequence CCAGGGAGGTGGCAAGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937333688_937333696 -5 Left 937333688 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
Right 937333696 2:121047562-121047584 CCTGGAGCTCTGCCCAGGACCGG No data
937333688_937333702 7 Left 937333688 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
Right 937333702 2:121047574-121047596 CCCAGGACCGGGGGCCATGGTGG No data
937333688_937333699 -2 Left 937333688 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
Right 937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG No data
937333688_937333698 -3 Left 937333688 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
Right 937333698 2:121047564-121047586 TGGAGCTCTGCCCAGGACCGGGG No data
937333688_937333707 23 Left 937333688 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
Right 937333707 2:121047590-121047612 ATGGTGGTCTCTGGCTCTGATGG No data
937333688_937333705 14 Left 937333688 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
Right 937333705 2:121047581-121047603 CCGGGGGCCATGGTGGTCTCTGG No data
937333688_937333700 4 Left 937333688 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
Right 937333700 2:121047571-121047593 CTGCCCAGGACCGGGGGCCATGG No data
937333688_937333692 -10 Left 937333688 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
Right 937333692 2:121047557-121047579 ACCTCCCTGGAGCTCTGCCCAGG No data
937333688_937333697 -4 Left 937333688 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
Right 937333697 2:121047563-121047585 CTGGAGCTCTGCCCAGGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937333688 Original CRISPR CCAGGGAGGTGGCAAGGCCT AGG (reversed) Intergenic
No off target data available for this crispr