ID: 937333699

View in Genome Browser
Species Human (GRCh38)
Location 2:121047565-121047587
Sequence GGAGCTCTGCCCAGGACCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937333686_937333699 17 Left 937333686 2:121047525-121047547 CCTGAGTGGCTACTTCTTTCCTA No data
Right 937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG No data
937333685_937333699 20 Left 937333685 2:121047522-121047544 CCTCCTGAGTGGCTACTTCTTTC No data
Right 937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG No data
937333682_937333699 29 Left 937333682 2:121047513-121047535 CCCCTGTGACCTCCTGAGTGGCT No data
Right 937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG No data
937333683_937333699 28 Left 937333683 2:121047514-121047536 CCCTGTGACCTCCTGAGTGGCTA No data
Right 937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG No data
937333690_937333699 -8 Left 937333690 2:121047550-121047572 CCTTGCCACCTCCCTGGAGCTCT No data
Right 937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG No data
937333688_937333699 -2 Left 937333688 2:121047544-121047566 CCTAGGCCTTGCCACCTCCCTGG No data
Right 937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG No data
937333684_937333699 27 Left 937333684 2:121047515-121047537 CCTGTGACCTCCTGAGTGGCTAC No data
Right 937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937333699 Original CRISPR GGAGCTCTGCCCAGGACCGG GGG Intergenic
No off target data available for this crispr