ID: 937334946

View in Genome Browser
Species Human (GRCh38)
Location 2:121056486-121056508
Sequence CAGTGGGGATGGAGAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937334929_937334946 27 Left 937334929 2:121056436-121056458 CCAGACTCTTCCTAACAGCCCAC No data
Right 937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG No data
937334934_937334946 9 Left 937334934 2:121056454-121056476 CCCACGGGAGCCAGCAGGAGCCA No data
Right 937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG No data
937334938_937334946 -1 Left 937334938 2:121056464-121056486 CCAGCAGGAGCCAGCAGGAGGCC No data
Right 937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG No data
937334935_937334946 8 Left 937334935 2:121056455-121056477 CCACGGGAGCCAGCAGGAGCCAG No data
Right 937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG No data
937334932_937334946 17 Left 937334932 2:121056446-121056468 CCTAACAGCCCACGGGAGCCAGC No data
Right 937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG No data
937334928_937334946 28 Left 937334928 2:121056435-121056457 CCCAGACTCTTCCTAACAGCCCA No data
Right 937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937334946 Original CRISPR CAGTGGGGATGGAGAGAGGA TGG Intergenic
No off target data available for this crispr