ID: 937336936

View in Genome Browser
Species Human (GRCh38)
Location 2:121067980-121068002
Sequence GAGGAACCGCGGCTCTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937336927_937336936 21 Left 937336927 2:121067936-121067958 CCTGGGTCACCTGTCACTTGTGT No data
Right 937336936 2:121067980-121068002 GAGGAACCGCGGCTCTGCGGTGG No data
937336933_937336936 -6 Left 937336933 2:121067963-121067985 CCACATAGGTGACTCGGGAGGAA No data
Right 937336936 2:121067980-121068002 GAGGAACCGCGGCTCTGCGGTGG No data
937336928_937336936 12 Left 937336928 2:121067945-121067967 CCTGTCACTTGTGTTTGTCCACA No data
Right 937336936 2:121067980-121068002 GAGGAACCGCGGCTCTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937336936 Original CRISPR GAGGAACCGCGGCTCTGCGG TGG Intergenic