ID: 937337629

View in Genome Browser
Species Human (GRCh38)
Location 2:121071585-121071607
Sequence GTGCACCCACCTGGTGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937337629_937337638 27 Left 937337629 2:121071585-121071607 CCATCAGCACCAGGTGGGTGCAC No data
Right 937337638 2:121071635-121071657 AGCTCCCTGGAATGTACATCAGG No data
937337629_937337631 -3 Left 937337629 2:121071585-121071607 CCATCAGCACCAGGTGGGTGCAC No data
Right 937337631 2:121071605-121071627 CACAGCCCATTGTCCTACAGAGG No data
937337629_937337634 4 Left 937337629 2:121071585-121071607 CCATCAGCACCAGGTGGGTGCAC No data
Right 937337634 2:121071612-121071634 CATTGTCCTACAGAGGCCAGAGG No data
937337629_937337636 14 Left 937337629 2:121071585-121071607 CCATCAGCACCAGGTGGGTGCAC No data
Right 937337636 2:121071622-121071644 CAGAGGCCAGAGGAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937337629 Original CRISPR GTGCACCCACCTGGTGCTGA TGG (reversed) Intergenic