ID: 937338718

View in Genome Browser
Species Human (GRCh38)
Location 2:121077425-121077447
Sequence GATGCATCCCAGACTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937338718_937338726 7 Left 937338718 2:121077425-121077447 CCTTCCAGAGTCTGGGATGCATC No data
Right 937338726 2:121077455-121077477 CATCGGCCTGGGGATGAAGGAGG No data
937338718_937338720 -10 Left 937338718 2:121077425-121077447 CCTTCCAGAGTCTGGGATGCATC No data
Right 937338720 2:121077438-121077460 GGGATGCATCTCAGAACCATCGG No data
937338718_937338722 -4 Left 937338718 2:121077425-121077447 CCTTCCAGAGTCTGGGATGCATC No data
Right 937338722 2:121077444-121077466 CATCTCAGAACCATCGGCCTGGG No data
937338718_937338721 -5 Left 937338718 2:121077425-121077447 CCTTCCAGAGTCTGGGATGCATC No data
Right 937338721 2:121077443-121077465 GCATCTCAGAACCATCGGCCTGG No data
937338718_937338724 4 Left 937338718 2:121077425-121077447 CCTTCCAGAGTCTGGGATGCATC No data
Right 937338724 2:121077452-121077474 AACCATCGGCCTGGGGATGAAGG No data
937338718_937338723 -3 Left 937338718 2:121077425-121077447 CCTTCCAGAGTCTGGGATGCATC No data
Right 937338723 2:121077445-121077467 ATCTCAGAACCATCGGCCTGGGG No data
937338718_937338727 8 Left 937338718 2:121077425-121077447 CCTTCCAGAGTCTGGGATGCATC No data
Right 937338727 2:121077456-121077478 ATCGGCCTGGGGATGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937338718 Original CRISPR GATGCATCCCAGACTCTGGA AGG (reversed) Intergenic
No off target data available for this crispr