ID: 937343019

View in Genome Browser
Species Human (GRCh38)
Location 2:121104019-121104041
Sequence CTGTCTTTCGCCTCAGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937343019_937343025 19 Left 937343019 2:121104019-121104041 CCAGAGCCTGAGGCGAAAGACAG No data
Right 937343025 2:121104061-121104083 CAAACGCTTCCTGGTCACTCTGG No data
937343019_937343023 10 Left 937343019 2:121104019-121104041 CCAGAGCCTGAGGCGAAAGACAG No data
Right 937343023 2:121104052-121104074 TGTGGGCCTCAAACGCTTCCTGG No data
937343019_937343022 -7 Left 937343019 2:121104019-121104041 CCAGAGCCTGAGGCGAAAGACAG No data
Right 937343022 2:121104035-121104057 AAGACAGAGCTCTGTTCTGTGGG No data
937343019_937343021 -8 Left 937343019 2:121104019-121104041 CCAGAGCCTGAGGCGAAAGACAG No data
Right 937343021 2:121104034-121104056 AAAGACAGAGCTCTGTTCTGTGG No data
937343019_937343026 20 Left 937343019 2:121104019-121104041 CCAGAGCCTGAGGCGAAAGACAG No data
Right 937343026 2:121104062-121104084 AAACGCTTCCTGGTCACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937343019 Original CRISPR CTGTCTTTCGCCTCAGGCTC TGG (reversed) Intergenic
No off target data available for this crispr