ID: 937344322

View in Genome Browser
Species Human (GRCh38)
Location 2:121114979-121115001
Sequence CCTGGGAGGCAGAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937344322_937344333 25 Left 937344322 2:121114979-121115001 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 937344333 2:121115027-121115049 TCCCGAGTAGCTGGAATTACAGG 0: 2259
1: 55039
2: 219904
3: 255826
4: 192186
937344322_937344330 16 Left 937344322 2:121114979-121115001 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 937344330 2:121115018-121115040 ACCTCAGCCTCCCGAGTAGCTGG 0: 6311
1: 132274
2: 300665
3: 217345
4: 143708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937344322 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG (reversed) Intergenic
Too many off-targets to display for this crispr