ID: 937345580

View in Genome Browser
Species Human (GRCh38)
Location 2:121123431-121123453
Sequence GGGGAGGTGAGCCGGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937345574_937345580 -4 Left 937345574 2:121123412-121123434 CCTCAAGGGCTGGGTACCAGGGG No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345568_937345580 6 Left 937345568 2:121123402-121123424 CCTGGCCTTGCCTCAAGGGCTGG No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345558_937345580 25 Left 937345558 2:121123383-121123405 CCCGGCCCTGCCCGGTCGCCCTG No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345564_937345580 14 Left 937345564 2:121123394-121123416 CCGGTCGCCCTGGCCTTGCCTCA No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345559_937345580 24 Left 937345559 2:121123384-121123406 CCGGCCCTGCCCGGTCGCCCTGG No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345561_937345580 20 Left 937345561 2:121123388-121123410 CCCTGCCCGGTCGCCCTGGCCTT No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345562_937345580 19 Left 937345562 2:121123389-121123411 CCTGCCCGGTCGCCCTGGCCTTG No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345563_937345580 15 Left 937345563 2:121123393-121123415 CCCGGTCGCCCTGGCCTTGCCTC No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345557_937345580 29 Left 937345557 2:121123379-121123401 CCAGCCCGGCCCTGCCCGGTCGC No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345556_937345580 30 Left 937345556 2:121123378-121123400 CCCAGCCCGGCCCTGCCCGGTCG No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345567_937345580 7 Left 937345567 2:121123401-121123423 CCCTGGCCTTGCCTCAAGGGCTG No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data
937345571_937345580 1 Left 937345571 2:121123407-121123429 CCTTGCCTCAAGGGCTGGGTACC No data
Right 937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937345580 Original CRISPR GGGGAGGTGAGCCGGGTGCC AGG Intergenic