ID: 937347224

View in Genome Browser
Species Human (GRCh38)
Location 2:121133523-121133545
Sequence GGCCCTGGGCGTAACATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937347218_937347224 2 Left 937347218 2:121133498-121133520 CCAGGACTTGGCAAGGCAAGGGA No data
Right 937347224 2:121133523-121133545 GGCCCTGGGCGTAACATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937347224 Original CRISPR GGCCCTGGGCGTAACATTGA AGG Intergenic
No off target data available for this crispr