ID: 937348395

View in Genome Browser
Species Human (GRCh38)
Location 2:121142697-121142719
Sequence AGCTGTACCCTGCAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937348386_937348395 8 Left 937348386 2:121142666-121142688 CCCTGGAATTGGGACCTGGGACC No data
Right 937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG No data
937348382_937348395 17 Left 937348382 2:121142657-121142679 CCACCAGAGCCCTGGAATTGGGA No data
Right 937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG No data
937348378_937348395 19 Left 937348378 2:121142655-121142677 CCCCACCAGAGCCCTGGAATTGG No data
Right 937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG No data
937348387_937348395 7 Left 937348387 2:121142667-121142689 CCTGGAATTGGGACCTGGGACCC No data
Right 937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG No data
937348376_937348395 27 Left 937348376 2:121142647-121142669 CCAGACAACCCCACCAGAGCCCT No data
Right 937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG No data
937348383_937348395 14 Left 937348383 2:121142660-121142682 CCAGAGCCCTGGAATTGGGACCT No data
Right 937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG No data
937348380_937348395 18 Left 937348380 2:121142656-121142678 CCCACCAGAGCCCTGGAATTGGG No data
Right 937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG No data
937348388_937348395 -6 Left 937348388 2:121142680-121142702 CCTGGGACCCCCGTCACAGCTGT No data
Right 937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG No data
937348375_937348395 28 Left 937348375 2:121142646-121142668 CCCAGACAACCCCACCAGAGCCC No data
Right 937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937348395 Original CRISPR AGCTGTACCCTGCAGTTGGT GGG Intergenic
No off target data available for this crispr